Ebooks

MOLECULAR, ENZYMATIC & BIOCHEMICAL ASSAYS FOR AGRICULTURAL PESTS

Srinivasa N, Bhupendra Kumar, Rakesh Verma
EISBN: 9789358877229 | Binding: Ebook | Pages: 0 | Language: English
Imprint: NIPA | DOI: 10.59317/9789358877229

100.00 USD 90.00 USD


INDIVIDUAL RATES ONLY. ACCESS VALID FOR 30 DAYS FROM THE DATE OF ACTIVATION FOR SINGLE USER ONLY.

This Book titled Molecular, Enzymatic and Biochemical Assays for Agricultural Pests focuses on fundamental molecular techniques, encompassing DNA extraction and sequence submission to the NCBI database. Additionally, it delves into protein estimation, immunoblotting, and real-time PCR.

Moreover, the book features biochemical assays, such as glucose and protein triglycerides estimation, as well as stress-responsive enzymes. It is expected that researchers from diverse fields will find these techniques valuable for their own investigations.
 

0 Start pages

Identification of pests in agricultural and horticultural crops is the first step in the decision-making process for pest management. The classical approach to identification is based on morphological techniques, which have their own limitations, like sexual dimorphism and the loss of characters in a preserved specimen over a period, and require specialized taxonomists. DNA barcoding is one molecular approach that helps in the identification of pests by sequencing the barcode gene and comparing the barcode gene sequences in reference databases such as NCBI and BOLD. This method is available for plants, animals, microbes, etc.

 
1 DNA Extractions from Insects
Twinkle Sinha, Varun Arya, Srinivasa Narayana

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K. Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification. Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

1 - 4 (4 Pages)
USD34.99
 
2 Amplification of the Mitochondrial Cytochrome Oxidase-1 (COX 1) Gene by the Polymerase Chain Reaction (PCR)
Varun Arya, Twinkle Sinha, Saniya Tyagi

Polymerase Chain Reaction (PCR) is a laboratory technique, developed by Kary Mullis in the 1980s, used in molecular biology to amplify and replicate a specific segment of the DNA (Mullis, 1990). This reaction in performed in a thermal cycler, involving three main steps: denaturation, annealing and extension. Principle: PCR is based on the principle of selectively amplifying a specific region of DNA through a series of temperature-controlled cycles. The key components involved in PCR include the target DNA sequence, oligonucleotide primers, DNA polymerase enzyme (Taq DNA polymerase), deoxyribonucleotide triphosphate (dNTPs) (A, T, G, and C), Mg2+ and a thermal cycler apparatus. Initially, the double-stranded DNA is split into single strands under high temperature of 90-95 0C known as the denaturation step. It is followed by cooling the solution to a temperature that allows proper attachment of the oligonucleotide primers to its complementary sites in the strands, known as the annealing step.

5 - 8 (4 Pages)
USD34.99
 
3 Separation and Visualization of DNA by Agarose Gel Electrophoresis
Saniya Tyagi, Varun Arya, Vishrutha C

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

9 - 14 (6 Pages)
USD34.99
 
4 Quantification of the Nucleic Acids Using the Nano-Drop Spectrophotometer and Submission of COI Sequences in NCBI Genbank
Vishrutha C, Varun Arya, Srinivasa Narayana

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface. Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.

15 - 28 (14 Pages)
USD34.99
 
5 DNA Extraction, Colony PCR and Evaluation of Biochemical Properties of Culturable Gut Bacteria from Insects
Vinay N, Srinivasa Narayana

Aim: To identify culturable gut bacteria from insects. Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc. Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp. Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

29 - 34 (6 Pages)
USD34.99
 
6 Immunoblotting
Sriparna Pal, Rakesh Verma

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane. 1. Preparation of tissue homogenate The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.  

35 - 46 (12 Pages)
USD34.99
 
7 Real-Time or Quantitative Polymerase Chain Reaction
Sriparna Pal , Rakesh Verma

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling. Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

47 - 52 (6 Pages)
USD34.99
 
8 Estimation of Biochemical Parameters in Insects
Parinita Singh, Priyanka Yadav, Arvind Kumar Patel , Sourabh Verma, Tamal Das, Pradeep Kumar, Simrata Dalpat, Preeti Chhanda Sahoo, Bhupendra Kumar

1. Introduction Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

53 - 56 (4 Pages)
USD34.99
 
9 Determination of Enzymatic Antioxidants in Insects
Parinita Singh, Priyanka Yadav, Arvind Kumar Patel, Priyanka Yadav, SourabhVerma, Tamal Das, Sikta Saroja, Sikta Saroja, Paritosh Sharma, Devendra Kumar Mishra, Bhupendra Kumar

1. Introduction Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

57 - 62 (6 Pages)
USD34.99
 
10 End Pages

A  Agarose gel electrophoresis, 9  Annealing, 5, 7, 8, 31  B  Biochemical Parameters, 53  Biological oxygen demand, 29, 30, 33  C  Catalase assay, 58  Catalase, 32, 58, 61  Cellulolytic test, 33  D  Denaturation, 5, 7, 31  E  Estimation of glucose, 54  Estimation of proteins, 54

 
9cjbsk
Payment Methods