eChapters

Globally, 2 billion children under the age of five suffer from diarrhoea, of which, more than 50% of the cases being in South Asia and sub-Saharan Africa, where the disease is more likely to be fatal (UNICEF-WHO, 2009). It has been also estimated that the great majority of acute diarrhoeal illnesses in children over the age of two years is attributable to bacterial pathogens (Carpenter, 1980). Amongst the various enteric bacterial pathogens, diarrheagenic strains of Escherichia coli are considerably responsible for causing bacterial diarrhea (Nataro and Kaper, 1998).

Genetic diversity is one of the fundamental character present in any population or species. It is the total variation either phenotypic or genotypic which have occured in a population through due course of evolution. Variation in any species depends on mutation, substitution (insertion/deletion) and response to selection. However, comprehensive studies on theoretical and empirical perspectives for diversity analysis may be found by evolutionary biologists to understand the factor that influences levels of genetic diversity in natural population (Lewontin, 1974). In brief, nucleotides/ protein codes are the basic unit to quantify total amount of variation. Bioinformatic tools and techniques help us to measure inferring relationships between genes, proteins or organisms through use of these DNA/protein sequences by integration of mathematical algorithms, statistical and computer databases.

Diversity analysis is popularly known as phylogenetic analysis in bioinformatic terms. The basic principle of phylogeny is analysis/alignment of characters; whether it is morphological or molecular data. For instance, in case of morphological data of a crop species, the leaf colour/stem colour/fruit colour/grain size etc. may be compared however sequence data is problem of interest for molecular phylogeny. The evolutionary history of any crop species/ organisms inferred from phylogeny analysis mostly depicted through treelike diagrams/ dendrograms. In this chapter, phylogenetic analysis based on only nucleotide/protein sequences are discussed. For analysis of phylogenetics, default assumptions (Baxevanis and Ouellette, 2006) are:

INTRODUCTION

Indigenous agroforestry systems exhibit a great intricacy with respect to their components where trees, shrubs, climbers and grasses are common. In the north-western Himalaya, farmers maintain naturally regenerating tree/shrub species, particularly on edges of terraced agriculture fields without any significant input of manpower. These systems are called as indigenous agroforestry system (Ram and Singh 1996; Vishvakarma et al. 1998, Thakur et al. 2004 and 2005). Shrubs have been meeting the fuel wood requirement of the local peasants from forest as well as village wasteland and field boundaries. Shrub dominated ecosystems extend from arctic to tropical region and occur over the entire moisture gradient from desert to wetland (Specth 1979; DI Castro 1981; West 1983). 

1. Introduction

India, as a party to the Convention on Biological Diversity (CBD), has obliged to document a whole range of organism diversity within her territorial boundaries, make all attempts to conserve these bio-resources and monitor the efficacy of the conservation measures adopted. With its diverse ecological conditions and unique geographical location, Indian landmass supports rich diversity of algal flora. However, this algal wealth needs to be systematically surveyed and documented from all possible habitats. Ecological patterns emerged from recent studies within India are assessed with the identification of knowledge gaps and conservation implications in algal systematics.

During last one decade, great advances have been made in the field of Algology/Phycology throughout the world. Over the years algae has attained a greater reputation and popularity because of its economic importance, particularly as food, for commercial products, water contamination, toxin production, sewage oxidation, municipal water purification in fisheries and above all for the study of fundamental scientific information. But before the algae put in to such important use, it is imperative to have a baseline data about the material in question. Without knowing the status of algal resources of any area one cannot have projections for their utilization or gain knowledge of their ecological role and functions. The taxonomy of algae is, therefore, a prerequisite for all applied fields of algae apart from academic interest. Recent global surveys have revealed that there is lack of knowledge about fresh water algal diversity of tropical countries including India.

1. Introduction

The gymnosperms constitute a distinct subdivision of spermatophytes, the seed bearing plants. The term ‘gymnosperm’ is derived from Greek words, gymnos, naked and sperma, seed, which indicates that these are naked-seeded plants, i.e., those in which the seeds are not enclosed within the fruits but are borne freely exposed on an open carpel. In contrast in the angiosperms the seeds are enclosed within a closed carpel (ovary). The first known use of the term gymnosperm was given by Theophrastus in 300 BC in his book “Enquiry into Plants” to describe “plants with unprotected seeds”. Goebel (1905) rightly described gymnosperms as “Phanerogams without ovary”. The Scottish botanist, Robert Brown in 1825 first distinguished gymnosperms from angiosperms. At one time they were considered to be single class of seed plants, called Gymnospermae, but taxonomists are now tend to recognise four distinct divisions of extant gymnospermous plants - coniferophyta (Pinophyta), Cycadophyta, Ginkgophyta and Gnetophyta. Geological history reveals that all divisions of gymnosperms have been distinct groups since their origin.

Among the gymnosperms are plants with stems that may barely project above the ground and others develop into the largest trees on the earth. The extant gymnosperms are a small group of plants comprising ca. 1026 species belonging to 83 genera and 12 families (Christenhusz et al. 2011). They are distributed throughout the world, with extensive latitudinal and longitudinal ranges. Economically, gymnosperms are of outstanding value, fulfilling the greater proportion of our timber as well as resin requirements. They are also the dominant forest makers of the world and in addition they play a leading role in the preservation of the environment (Sahni 1990). By far the largest group of living gymnosperms is the conifers (pines, cypresses and relatives), followed by cycads and Gnetales (Gnetum, Ephedra and Welwitschia).

4.1 General description

Most temperate forest habitats support a small number of animal and tree species with wide geographic distributions, whereas the montane forests support a large number of species with narrow geographic distributions. "For mankind's most prevalent disease, we have a multiplicity of diagnoses, each provided with maximum casualness," Prof Galbrith writes in one of his publications. Poverty is a difficult situation to be in. It would be beneficial if we knew what was causing the problem. Obviously, there isn't a single answer. Many explanations are presented because they include a small amount of truth. However, one reason of poverty is pervasive: the historical or present link between land and people. Food, clothing, and shelter are all provided by the land. Poverty exists if these are not available." This statement by Galbrith, which is relevant for shifting agriculture areas with excessive rains and turbulent rivers, summarizes the genesis and cause of every responsible individual's considerable worry for good land management and soil maintenance. To round out the aspects of this issue, there is need to add 'environment' and 'ecology’ to this.

Many microbes have ability to attach to various surfaces forming three dimensional extracellular matrix within which embedded the microbes grow and multiply forming thin layer structure called biofilm. Biofilms may form on living or non-living surfaces and can be prevalent in natural, industrial and hospital settings (Hall-Stoodley et al., 2004). Biofilm mainly consist of three components - bacteria, matrix and surface. Extracellular matrix generally composed of extracellular polymeric compounds such as extracellular polysaccharides, proteins, phospholipids, DNA, teichoic and nucleic acids, and other polymeric substances hydrated to 85 to 95% water and polysaccharides (Hall-Stoodley et al., 2004).

Turmeric (Curcuma longa L.) is a tropical herbaceous plant extensively cultivated in India, Sri Lanka, parts of China and Pakistan.  Country of origin is not known with certainity, it is either of Chineese or Indian origin. India ranks first in area (1.49 lakh ha.) and production (5.27 lakh tonnes.) in the world and it is grown in most of the states in the country.  Major turmeric growing states are Andhra Pradesh (56,000 ha.), Orissa (23,000 ha.), Tamilnadu (17,000 ha.), Assam (12,000 ha.), West Bengal (11,000 ha.) Maharashtra (6,000 ha.)  Karnataka (6,000 ha.) and Kerala (3,000 ha.).  Andhra Pradesh ranks first in area and production in the country. Area under this crop is increasing in North Eastern States.

Turmeric belongs to family Zingiberaceae and genus Curcuma. Genus Curcuma has 42 species, of which Curcuma longa is extensively cultivated for culinary purposes, Curcuma aromatica for flavour and recently Curcuma amada (mango ginger) for preparation of chutneys. Turmeric is mainly cultivated for under ground rhizomes, rich in curcumin. Turmeric is traditionally used for medicinal, religious, culinary purposes and also as a cosmetic and dye (Shah 1997). Recent reports in controlling human cancer has given renewed interest on the crop. In Ayurveda, turmeric is regarded as aromatic, a stimulant tonic, carminative and anti helminthic. Essential oil of turmeric is antiseptic and is used in treating gall stones and gall complaints (Pruthi 1976).

Abstract

A field study of seven arid districts of Rajasthan was undertaken to evaluate the occurrence of selected tree species and arbuscular mycorrhizal fungal (AMF) associations with them. Five genera were identified in the rhizosphere of these selected tree species. A high diversity of AMF was observed which varied between different host tree species. Among the five genera, Glomus occurred most frequently, with four species, Acaulospora and Gigaspora were found with three species, while Entrophospora and Scutellospora was detected with two species. Gigaspora margarita, Gigaspora rosea, Glomus deserticola, Glomus constrictum, Glomus fasciculatum, Glomus mosseae and Scutellospora calospora were the most dominant species. The AMF spore density was not clearly affected by the host tree suggesting that biotic factors may be relatively less important than abiotic/edaphic factors for establishing population pattern. The spore density of AMF had a strong positive correlation with soil pH and organic carbon content and a negative correlation with Olsen’s P content of the soil. The association with AMF of these tree species native to the harsh environmental conditions of the Indian Thar Desert may play a significant role in the re-establishment and conservation of these multipurpose desert tree species.

INTRODUCTION

Biodiversity can be useful as an ecosystem indicator for conservation and monitoring, through continuous assessment of its main properties including stability, primary productivity, exploitation tolerance and even global environmental changes (Douglas et al., 2012). Crustaceans are found one of the most morphologically diverse taxonomic groups on the planet (Martin and Davis, 2001). Among them, decapods are the most studied taxon, mainly on account of the commercial interest of some species and their great diversity (Isarch and Munoz, 2015). Decapods are chiefly composed of marine species that live in waters depths ranging from shallow to deeper than 5000 m. Isarch and Munoz (2015) described the importance of this group lies in several factors such as the great biomass they represent, their significant role in marine food webs and the commercial interest of many decapod species. Order Decapoda comprises the commercially important shrimps, crabs and lobsters. Out of 649 species of marine crabs so far recorded from Indian waters, only 12 species of edible crabs namely Portunus sanguinolentus, P. plagicus, Charybdis feriatus, C. lucifera, C. annulata, C. natator, Scylla serrata, S. tranquebarica, Matuta lunaris, Sesarma tetragonum and Varuna litterata, which inhabit the coastal waters and adjoining brackishwater environments, support commercial fisheries (Menon and Pillai, 1996). However substantial quantities of crabs are landed every year as by-catches of shrimp trawlers and indigenous fishing units throughout the county.

India represents one of the major contributors to the world production of marine crustaceans. Shrimps constitute as the main seafood export industry for the major foreign exchange earner as well as a source of livelihood for millions of fish workers. As shrimps are targeted for fishing, information on the present status of the fishery is critical for implementation of proper management. Some of the important penaeid shrimps that support commercial fisheries along the Indian seas are Fenneropenaeus indicus, P.semisulcatus P.monodon, P.merguiensis, P.japonicus, P.penicillatus, Metapenaeus dobsoni, M.monoceros, M. affinis, M. kutchensis , M. brevicornis, Parapenaeopsis stylifera, P.hardwickii, P.sculptilis, P.maxillipedo, P.uncta, Trachypenaeus curvirostris, Metapenaeopsis stridulans, Parapenaeus longipes, Solenocera crassicornis and S.choprai (Mohan Joseph and Jayaprakash, 2003). Rajkumar et al. (2015) carried out molecular identification of shrimp species, Penaeus semisulcatus, Metapenaeus dobsoni, Metapenaeus brevicornis, Fenneropenaeus indicus, Parapenaeopsis stylifera and Solenocera crassicornis from Tamil Nadu, India.

Mastitis is a global problem as it adversely affects animal health, quality of milk and economics of milk production. Bovine Mastitis is reported to be the most costly disease of dairy cattle, causing huge economic losses in terms of reduced milk yield, milk discard after treatment, cost of veterinary services and premature culling. While reviewing status of mastitis in India, subclinical mastitis is more important (10–50%) than the clinical mastitis (1-10%). Estimated annual economic losses incurred due to mastitis estimates to Rs.7165.57 crores to dairy farmers (Bansal and Gupta, 2009).

Introduction

Rice contains essential micronutrients such as iron (Fe), zinc (Zn), copper (Cu), calcium (Ca), manganese (Mn), magnesium (Mg), etc. which are generally lower when compared with other staple crops like wheat, maize, legumes, and tubers (Adeyeye et al. 2000). The most crucial micronutrients are iron and zinc, whose inadequacy is a leading cause of malnutrition. In this chapter we discuss estimation methodologies and diversity of Fe and Zn, its genetic basis, and improvement for micronutrient content through breeding techniques.

Procedure of Estimation of Fe and Zn Content in Rice Grain

Iron and zinc concentrations in rice samples were generally estimated by colorimetric method Atomic Absorption Spectrometry (AAS), X-ray Fluorescence (XRF), and Inductively Coupled Plasma Optical Emission Spectrometry (ICP-OES). X-Ray Fluorescence (XRF) Spectrometry is extremely helpful in the non-destructive estimation of relative Zn and Fe concentration in rice breeding lines and large germplasm collection (Paltridge et al. 2012). The majority of biofortification programs employ XRF as a metal analysis tool. For estimation of Fe and Zn, panicles of middle row plants of each replication were harvested, sun-dried for 4-5 days to reduce the moisture content to 11-12 %, and then seeds were dehusked. Each brown rice sample of about 5g was subjected to energy dispersive X-ray fluorescent spectrophotometer (ED-XRF) as per standard protocol (Stangoulis and Sison 2008, Rao et al. 2014) and expressed in ppm (µg g-1).

Abstract

Nematodes are non-segmented worms typically 50 µm in diameter and 1 mm in length. Those few species responsible for plant diseases have received a lot of attention, but far less is known about the majority of the nematode community that plays beneficial roles in soil. Nematode diversity tends to be greatest in ecosystems with the least disturbance. Species of Aphelenchoides, Ditylenchus spp, Helicotylenchus, Meloidogyne spp., Pratylenchus, Scutellonema  and Rotylenchulus are obnoxious plant parasitic nematode beside Heterodera and Globodera. Soil temperature, soil structure, soil pH, soil moisture and soil texture play major role in movement of nematode, infestation and completion of life cycle under abiotic and biotic stresses.

Introduction

Lactic acid bacteria (LAB) are characterized as Gram-positive cocci or rods, non-aerobic but aerotolerant, able to ferment carbohydrates for production of energy and lactic acid. Lactic acid bacteria includes different major genera: Lactococcus, Enterococcus, Lactosphaera, euconostoc, Melissococcus, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus and Weissella. Other genera are Aerococcus, Microbacterium, Propionibacterium and Bifidobacterium. Through carbohydrate fermentation along with lactic acid, various organic acids are produced due to which there is a fall in pH level and creates unfavorable environment or inhibits growth of some undesired microorganisms. The low pH makes organic acids lipo -soluble, allowing them to invade into cytoplasm of pathogens by rupturing cell membrane. LAB are generally regarded as safe (GRAS), and have a significant role in the preservation of foods and fermented products. Under controlled conditions they can be used as natural competitive microbiota or as specific starter cultures. Antagonistic substance like bacteriocins are produced from lactic acid bacteria that inhibits the activity and growth of other bacteria and these bacteriocins are active against various pathogens in minimum concentration. These are antimicrobial peptides modified by post -translational mechanisms and exported to the extracellular medium. Till date about 239 bacteriocin producing LAB genome and 789 putative bacteriocin producing genes cluster are stored in the public databases. Many gram positive and gram negative bacteria in the environment produce bacteriocins.

Abstract

Desert or arid regions present a unique environment for microbial growth. Thar Desert of India harbours a plethora of nitrogen fixing bacteria ranging from symbiotic nitrogen fixers, free living nitrogen fixers, associative nitrogen fixers and blue green algae or cyanobacteria. But the knowledge and extent of diversity is still limited to explore their full potential. On top of that, the documentation of the available knowledge is also scattered. Nitrogen-fixing bacteria are crucial for the protection of the nitrogen supply for vegetation in the arid region. Since deserts are poor in soil nitrogen, biological nitrogen fixation plays a crucial role in maintaining soil fertility. In this article, an attempt has been made to cover the nature and extent of diversity in nitrogen fixing bacteria in Indian arid zone.

ABSTRACT

Pesticide degradation is the breaking down of toxic pesticides into a non-toxic compounds and, in some cases, down to the original elements from which they were derived. The most common type of degradation is carried out in the soil by microorganisms, especially the fungi and bacteria. Microbial degradation depends not only on the presence of microbes with the appropriate degradative enzymes, but also on a wide range of environmental parameters. Pesticides which are rapidly degraded are called non-persistent while those which resist degradation are termed as recalcitrant (persistent). Microorganisms are able to degrade a large variety of compounds, including pesticides under laboratory conditions. However, methods have yet to be developed to decontaminate the environment from pesticide residues. Continuous efforts are required in this direction, and at present several PGPR capable of degrading pesticides have been isolated from the natural environment. Catabolic genes responsible for the degradation of several xenobiotics, including pesticides, have been identified, isolated, and cloned into various other organisms such as Streptomyces, algae, fungi, etc. In addition, recombinant DNA studies have made it possible to develop DNA probes that are being used to identify microbes from diverse environmental communities with a unique ability to degrade pesticides. Bioremediation treatment still requires more intense research through specific microbial degradation of broad range of organic pollutants. This review describes recent advances in biodegradation of pesticides by addressing the microbes involved in pesticide degradation.

Microbial diversity is the key to human survival and economic well being. It provides a huge reservoir of resources which can be utilized for our benefit. Yeasts have been isolated from many sources for industrial purposes. The impact of yeasts on food and beverage production extends many fold beyond the popular notions of bread, beer and wine fermentations by Saccharomyces cerevisiae.

Diverse dynamic mixed populations of prokaryotic and lower eukaryotic microorganisms govern the fermentation and maturation processes and, finally, impact the quality of wine. Both of these parameters apparently contribute to regional differences in the quality of produced wines and characterization of regional wines should involve the study of microbial populations and their members active in the given region.

ABSTRACT

The current paper discusses the diversity, distribution and commercial importance of Indian Magnolias. Globally, these species are found in tropical, subtropical and temperate forests of southeastern Asia and tropical America. In India, there are 25 species of Magnolias and most of them are distributed in Northeast India, with highest number in Assam. Of all the species, two (Magnolia gustavii and M. pleiocarpa) are critically endangered, one (M. pealiana) endangered, two (M. manii and M. nilagirica) vulnerable, nine least concern and ten data deficient at global level. The highly threatened nature of most of the magnolias species calls for their immediate conservation and protection measures. Members of this genus are known to be rich in a wide variety of biologically active compounds including alkaloids, flavonoids, lignans, neolignans and terpenoids. Many of the species have been found to possess potent procognitive activity, anti-oxidative, anti-microbial, anti-inflammatory, anti-angiogenic, diuretic, anti-ulcer, analgesic, anti-helmintholytic, and anti-cancer activities. The species have huge economic potential and are used for a number of purposes including ornamental, medicinal, culinary, timber and joinery works.

INTRODUCTION

The entire Himalayan region is vast and its diverse geographical grouping is unique and has complex ecosystem and occupies about 18% of the total geographical area of India. Indian Himalaya (27O 50' – 37O 06' N and 72O 30' – 97O 25' E) includes the parts of trans, north-west, west, central and east Himalaya and covers approximately an area of 4,19,873 Km2 with 2500 Km length and 240 Km width. The north-western Himalayas generally represent the Himalayan tract from Kumaon in Uttar Pradesh to Chitral in Gilgit. The Himalayan ranges situated in this region exhibit a diverse climate, topography, vegetation, ecology and land use pattern. The annual average rainfall varies from 8 cm in Ladakh to over 200 cm in some parts of Himachal Pradesh and Uttar Pradesh. The vegetation may vary from the scrub in the lower hills to arctic in the Greater Himalayas. The unique physiography, climatic conditions and soil characteristics of the area has resulted in a variety of habitats and a significant biological and cultural diversity. Along the altitudinal gradient (300-800 m.a.s.l) the vegetation varies from sub-tropical, temperate, sub-alpine to alpine types. It supports about 8000 species (47.06% of the total flowering plants of India) of which 30% are endemics, 10.2% trees, 8.44% wild edibles and over 15% medicinal (Samant and Dhar 1997).

Abstract

Lianas are slightly lesser known angiosperms, grows typically in the form of climbing vines mostly in tropical and subtropical forests. Such plants are characterized by scandent thick stems, woody stem in nature and vary in shape and size. They depend on supports in the form of trees, fence and usually climb upward towards the sunlight as they needed for their survival. Keeping the importance of lianas in forests and household, this study was conducted to document the liana angiosperms growing in Western Himalaya along with their medicinal potential for human and animals. This study reveals a total 64 lianas species belonging to 24 families recorded from Jammu and Kashmir, Ladakh, Uttarakhand, Himachal Pradesh and Punjab. This investigation also provided with medicinal potential of these species, which is used as ethnomedicine by local people living in the interior regions of hills and mountains of Himalaya. In this communication, we highlight lianas as an example of an underestimated forest element that, on the one hand, is a key component in and around forests. This study also helps in conservation of endangered liana species in Himalaya.

1. Introduction

Fungi are ubiquitously present in air, water, soil and organisms, or on organism surfaces. They are a group of eukaryotic system that are of great applied and scientific interest to common man, microbiologists, agriculturists and industrialists. They are a diverse group of organisms with respect to taxonomy, size, morphological appearance, mode of nutrition and reproduction. Fungi are eukaryotic spore bearing protists that lack chlorophyll. Fungi comprise the molds and yeasts. Yeasts are usually unicellular measuring only several microns in diameter, whereas molds are filamentous and multicellular which may grow up to several meters in diameter like the extremely large polypores. Fungi generally reproduce both sexually and asexually (Gow and Gadd 1995).

Although it is not easy to define fungi, biologists currently use the term “Fungus” to include nucleated, spore bearing, achlorophyllous organisms with absorptive nutrition which generally reproduce sexually and asexually, and whose filamentous branched somatic structures are typically surrounded by cell walls containing cellulose of chitin or both. A feature which all fungi have in common is their mode of nutrition. Like animals, fungi are heterotrophic organisms, which must consume preformed organic matter. They may live as saprophyte or parasites. They are of great economic importance to man and play an important role in the disintegration of organic matter and affect us directly by destroying food, fabric, leather and other commercial goods. They are responsible for a large number of diseases of plants, animals and man.

Horticulture is a wide field and includes a great variety and diversity of crops. In general, these crops are classified as follows:

1. Crops grown for the food and/or vitamin and mineral content, for e.g., apple and sweet potato.

2. Crops grown for their beverage properties, for e.g., tea and coffee.

3. Crops grown to beautify the environment, for e.g., the grasses of the well planned lawn.

4. Crops grown to express sentiments, for e.g., cut roses, jasmine.

5. Crops grown for perfume for e.g., rose, jasmine.

6. Crops grown for spices for e.g., pepper, nutmeg.

UNTIL THE 1940S BIOLOGISTS ARGUED ABOUT WHETHER DNA OR PROTEIN WAS THE MOLECULE OF HEREDITY

Nuclei observed to divide when cells reproduced themselves

Large amounts of both DNA & protein in the nucleus

Many though protein was most likely molecule of heredity

Proteins made of 20 different amino acids- could have more variety than DNA (made of only 4 different bases)

Abstract

Despite several controversies surrounding the genetically modified (GM) crops or their produce, the production of such crops is constantly increasing, especially in developing countries. To regulate the GM produce in the market, several countries have set very strict regulatory procedures for the approval to grow, import or utilize these GM crops as food or food ingredients. Hence, for regulatory compliance on GM labeling and identification of genetic traits, the development of reliable, sensitive and precise detection assays have become essential. The detection of GM produce is carried out by detecting either the inserted foreign DNA or the novel transgenic protein specifically expressed in GM crops. This article broadly focuses on some DNA and protein-based detection methods employed for GM produce and significant current advances in such detection technologies.

Delineating species boundaries correctly and also identifying species are crucial to the discovery of life’s diversity because it determines whether different individual organisms are members of the same entity or not (Dayrat, 2005). The identification of species depends on the knowledge held by taxonomists whose work cannot cover all taxon identification requested by non-specialists. To deal with these difficulties, the ‘DNA Barcode of Life’ project aims to develop a standardized, rapid and inexpensive species identification method accessible to non-taxonomists.

DNA barcoding is a technique in which species identification is performed by determining and comparing the sequences of several hundred base pairs of nucleotides from a small fragment of an identified gene, with the aim of contributing to a wide range of ecological and conservation studies in which traditional taxonomic identification is not practical (Krishnamurthy and Francis, 2012). The two main ambitions of DNA barcoding are to assign unknown specimens to species and to enhance the discovery of new species and facilitate identification, particularly in cryptic, microscopic and other organisms with complex or inaccessible morphology (Hebert et al., 2003a). Apart from these, identification of species previously defined by other criteria to also is an objective of barcoding. Another major objective could be the definition of operational units for ecological studies. This may also be used for forensic purposes by linking the specimens with already identified databases.

Introduction
DNA barcoding is a molecular taxonomic method used to identify species by analyzing variations in conserved DNA sequences that differ among species. The concept of “barcoding” refers to pooling multiple samples and sequencing and analysing them collectively. This technique has been widely applied to identify organisms ranging from simple to complex forms. Unlike other genetic markers, such as short tandem repeats (STR), which are typically used to identify individual organisms, DNA barcoding enables broader species identification. However, identifying species-specific DNA sequences across different taxa can be complex and time-consuming. For accurate species differentiation, the variation in DNA sequences must be sufficiently high to clearly distinguish between closely related species (Antil et al., 2023).
DNA barcode sequences are stored in databases like the Barcode of Life Data Systems (BOLD), which is an online repository containing reference DNA sequences for comparison with unknown samples. These databases store speciesspecific genetic sequences, specimen images, and related data, and also track updates to barcode libraries (Jin et al., 2020). DNA barcoding has progressed alongside genomics research, with large online libraries serving as reference databases for identifying samples from various environments like gardens, forests, and even commercial products (Seethapathy et al., 2019).
As research advances, the number of conserved genomic regions used for DNA barcoding continues to grow. For phylogenetic analysis, the rbcL gene locus is commonly used, along with other regions such as the trnL-F intergenic spacer, matK, ndhF, and atpB (Shaw et al., 2005). The CoxI gene has been wellestablished for barcoding animals and plant species. The trnH, psbA region of the plastid has been proposed as a universal barcode for terrestrial plants (Ward et al., 2005). Several other conserved genomic regions have been established by a “plant working group” for molecular taxonomy (Singh et al., 2012). Despite these advancements, further critical evaluations of the authenticity of these DNA barcoding markers in assessing biological diversity are still needed. Over the last few decades, DNA barcoding has become a widely used tool for confirming species identification, as evidenced by the growing body of research publications on the topic (Rob et al., 2019).Publications on DNA barcoding have seen a notable increase, as shown by a search using specific keywords in the CabDirect database (http://www.cabdirect.org/). This trend highlights the growing importance of DNA barcoding in taxonomic research

Introduction
Pathogenic organisms that cause diseases in plants are generally referred to as plant pathogens. Fungi, bacteria, viruses, viroids, algae and protozoa are the important phytopathogenic organisms responsible for plant diseases and they cause immense economic losses to growers. Recent estimates indicate that crop losses due to diseases range from 17-30%, primarily caused by fungal, oomycete, and nematode pathogens (Agrios, 2005). Beyond biotic factors, crop losses can also be attributed to abiotic causes, such as poor agricultural practices, nutrient deficiencies, changes in temperature and rainfall patterns, inadequate/overirrigation and weather extremes, all of which exert selection pressure on plant pathogens, potentially leading to new host infections. Hence, for effective disease management strategy, accurate identification and diagnosis of plant pathogens are of paramount importance before the pathogen induces any epidemic leading to immense loss of crop plants which is certain. Often, identification can be accomplished either visually through microscopic observation of disease-causing micro-organisms or molecular diagnosis based on nucleic acid detection methods. Microscopic observations alone are inadequate for species-level identification of plant pathogens and can often lead to taxonomic errors due to the potential for misidentification of organisms. Nucleic acid-based diagnostic tools allow for the sensitive detection, precise quantification, and specific differentiation of pathogens.Although numerous nucleic acid-based methods are available for plant pathogen detection, PCR-based diagnostics, especially those employing DNA barcodes, are still considered highly reliable and accurate. Scientists, especially plant pathologists, can now easily identify and diagnose most plant diseases as many standardized phytopathogen barcodes facilitate rapid, early, and accurate identification of plant diseases.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Previous Year Questions

1. What is DNA fingerprinting? Discuss the applied aspects in modern agriculture. (15M, CSE 2021)

• The term DNA fingerprinting in its original sense refers to the method developed in 1985 by Sir Alec Jeffreys (Jeffreys et al., 1985) and his associates for the simultaneous detection of highly variable DNA fragments by hybridisation of specific multilocus probes to electrophoretically separated restriction fragments?

• The DNA fingerprints, resembling barcodes, are unique to the individual and hence can be used in much the same way as conventional fingerprints - to identify individuals with absolute certainty?

DNA Fingerprinting Techniques

• A large number of fingerprinting techniques are in currency, which are variations and combinations of restriction fragmentation and polymerase chain reaction (PCR).

• Restriction fragment length polymorphism (RFLP) involves digesting DNA with restriction enzymes, separating the resultant DNA fragments by gel electrophoresis, blotting the fragments to a filter and hybridising probes to the separated fragments. Specific probe-enzyme combinations give highly reproducible patterns.

• With the advent of PCR technology a number of simpler techniques have become available for molecular characterisation.

• These include, random amplified polymorphic DNA (RAPD) and its several variants, intersimple sequence repeats (ISSR), amplified fragment length polymorphism (AFLP) and sequence tagged microsatellites sites (STMS).

Introduction
Rice is a key crop that directly feeds about half of the global population, with most of it consumed in developing countries (Wang et al., 2018). It is cultivated in many different types of environments and is always being enhanced by the creation of new varieties and the assessment and conservation of germplasm collections. To improve rice diversity and increase its genetic range, numerous researchers and organizations have been attempting to bring long-forgotten types back into production.This variation among varieties is essential for breeders as it provides genetic traits that can be incorporated into commercial varieties, such as resistance to diseases and pests, tolerance to abiotic stresses and improvements in grain nutritional quality, among others. In some cases, specific new traits areintroduced through crosses made with distantly-related genotypes. As a result of these efforts, despite being one of the first domesticated crops, cultivated rice continues to tap into a vast gene pool (Vieira et al., 2022).
There are over 500,000 rice accessions stored in gene banks around the world (Genesys 2021). To further explore the molecular diversity of this germplasm International Rice Research Institute (IRRI), Chinese Academy of Agricultural Sciences and BGI-Shenzheninitiated the 3K Rice Genome Project. This project focused on the most important rice species, Oryza sativa, and involved resequencing 3,000 rice genomes selected from the available genetic diversity, creating an invaluable resource for large-scale genetic variation discovery in this species (Vieira et al., 2022).
Varietal identification and classification in breeding programs are typically assessed using the distinctness, uniformity, and stability (DUS) approach, which relies on morphological descriptors (Tiwari et al., 2013). However, using morphological data/markers to determine genetic variation has limitations due to the labor-intensive, time-consuming nature of the process, as well as theagronomical traits and season-specific that are heavily influenced by ecologicalaspects. The development of genetically and morphologically similar varieties has made the task of clearly distinguishing between them increasingly complex. These environmental challenges necessitate the use of new techniques that are fast, reliable and environmentally independent.Biochemical and chemical tests fail to accurately estimate genetic distances among closely related genotypes. PCRbased molecular markers, however, are fast, reliable, and effective for determining the genetic purity of crop varieties (Rana, 2006). Hypervariable microsatellites (Teymnykhet al., 2011) offer a valuable source of polymorphic DNA markers, connecting genetic maps to genomic sequences and, ultimately, to phenotypic variation. SSR-based “DNA barcodes” are unique patterns of SSR polymorphism that assist in the precise identification of varieties, providing stability and resistance to environmental influences, epistatic interactions, and pleiotropic effects.

Introduction
Plant genetic resources (PGRS) encompasses everything that is on the earth related to the plants which are beneficial to mankind (Appazov,2008). So, it is the basic raw material for crop improvement (Somsenet al., 2002). In the present regime of transgenic crops, you can have ‘designer crops’- crops of your willingness (Wisner et al., 2001). From the heritage of mankind to the sovereign rights of the states this is the path that PGRs have traversed, earlier before CBD (Conventional Biological Diversity)(Chakraborty et al., 2018) PGRs were considered as a heritage of mankind freely available to everybody but after signing that they became the sovereign rights of the states with sovereign rights of the nation (Brahmiet al., 2015). In such a scenario where states have their rights on those plants’ genetic wealth, protection becomes very important (Clevelandet al., 1997). DNA fingerprinting is one of the technologies which can facilitate that protection (Wanget al., 2019).Rapeseed-mustard (Brassica spp.) is a vital oilseed crop cultivated extensively in India and other parts of the world (Kumaret al., 2008). It plays a crucial role in ensuring edible oil security and contributes significantly to the agricultural economy(Pahariyaet al., 2007). The genetic diversity within rapeseed-mustard species is a key factor in improving yield potential, disease resistance, and oil quality through breeding programs (Chandet al., 2021). However, accurately identifying and characterizing varieties is a challenge due to phenotypic similarities, environmental influences, and potential genetic erosion(Chhikaraet al., 2024). To address these challenges, DNA fingerprinting has emerged as a powerful molecular tool for precise varietal identification, genetic purity assessment, and germplasm conservation (Hosseinpouret al., 2024).DNA fingerprinting involves the use of molecular markers to generate unique genetic profiles of plant varieties, enabling breeders and researchers to differentiate between closely related cultivars (Singhet al., 2022; Singhet al., 2014). This technology is instrumental in breeding programs, ensuring the registration and protection of plant varieties under legal frameworks such as the Protection of Plant Varieties and Farmers’ Rights Act (PPV&FRA) in India (Williamet al., 2024). Additionally, DNA-based markers provide valuable insights into genetic relationships, aiding in the efficient selection of parent lines for hybridization and improving crop resilience to biotic and abiotic stresses (Nadeemet al., 2018; Haqueetal., 2021).Over the past two decades, several DNA fingerprinting techniques, including Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Simple Sequence Repeats (SSR), and Single Nucleotide Polymorphisms (SNPs), have been widely applied to characterize rapeseed-mustard varieties (Nybomet al., 2014; Panjabietal.,2019) Advances in high-throughput genotyping and nextgeneration sequencing (NGS) technologies have further enhanced the resolution and accuracy of genetic profiling, paving the way for marker-assisted selection (MAS) and genomic-assisted breeding strategies (Sinhaet al., 2023).

ABSTRACT

DNA fingerprinting is increasingly being used for identification of varieties, quantification of similarity between varieties and study of genetic diversity available in the population.

This is all the more important in crops where morphological variability is less or one variety is known by different names or different varieties are known by same name.

DNA fingerprinting using RAPD method has been standardized for tapioca. Dellaporta method has been used for extraction of DNA and amplification was done following William’s method. This technique has been used for molecular characterisation of accessions and identification of duplicates in the germplasm maintained at Central Tuber Crops Research Institute, Thiruvananthapuram. This technology has been extended for DNA fingerprinting of released varieties and also some of the elite breeding lines.

Eleven varieties released from the institute were fingerprinted using a few primers, which showed high polymorphism in tapioca. One single primer gave distinct banding pattern for all the 11 varieties and it was capable of earmarking each variety.

Individual variety was finger printed for 20 different primers and the results were documented. This technique is being extended to promising land races as well. DNA fingerprinting will be useful for protecting Plant Breeders’ Right as well as Farmers’ Right in the new Patent Regime.

Introduction
DNA fingerprinting envisages a very significant molecular methodology employed for identification and characterization of wheat varieties and germplasm. It is of utmost importance in varietal authentication, rights protection of breeders, and analysis of genetic diversity. Currently employed molecular markers like SSRs, SNPs, and DArT are applied extensively for wheat fingerprinting. Such markers precisely differentiate closely related varieties and aid in breeding programs (Babu et al., 2020; Kiss et al., 2021).
The current standing of wheat DNA fingerprinting shows a trend toward high-throughput genotyping and genomic selection strategies to accelerate crop improvement. Future prospects would entail the integration of advanced sequencing technologies such as Next-Generation Sequencing (NGS) and machine learning for genetic analysis. These technologies will ease wheat breeding and dramatically contribute to food security and climate-resilient agriculture. Expanding the global DNA fingerprinting database would further enhance global wheat germplasm conservation and utilization (Sandhu et al., 2021; Ahmadi et al., 2020). Wheat (Triticum spp.) is one of the major staple crops of the world, supporting the sustenance of over one-third of the total world population. It is the main source of carbohydrates, proteins, fibers, and other important micronutrients, making it very important for human nutrition. Wheat is cultivated mainly in all types of agro-climatic zones, with major producers being China, India, Russia, United States, and the European Union.
Wheat is highly valuable not only in terms of food security, but also economically with millions of farmers involved in its production and trading worldwide. Wheat is an important raw material for many food products, such as bread, pasta, and baked goods. Wheat production faces challenges from climate change, pests, and emerging pathogens. Therefore, continuous research on wheat, genetic improvement for desirable traits, and sustainable agricultural practices are needed to enhance yield, resilience, and in turn global food security. Genetic diversity in wheat is pertinent for fulfilling food security at the global level and for the success of breeding programs, apart from giving diverse traits for resistance against pests, diseases, and environmental stresses like droughts

Apoptosis is triggered by extrinsic and intrinsic stimuli as radiation, oxidative stress and genotoxic chemicals. It is defined by characteristic changes in the nucleus morphology including chromatin condensation and fragmentation, overall cell shrinkage/rounding and formation of apoptotic cell bodies. Among the many markers of apoptosis, DNA fragmentation is considered a hallmark. The DNA ladder assay described here is a simple, sensitive, cost-effective and rapid method for estimating apoptosis in cells.

Isolation of Genomic DNA

Genomic DNA from primary cells culture of PMNC and splenocytes of rats is isolated by using standard phenol-chloroform DNA isolation protocol of Sambrook and Russel (2001) as described below:

1. Preparation of primary cells culture of different cells, namely-PBMNCs, thymocytes and splenocytes form Wistar rats and viability checked by trypan blue dye exclusion test.

2. 106 cells/ml of primary cell culture is used and seeded in 24 well culture plates containing along with treatment with xenobiotics at different µM concentration.

3. Cell culture plates are incubated in CO2 incubator at 37°C with 5% CO2 for 12 hrs.

4. The cells are collected in 1.5 ml of micro centrifuge tube and centrifuged at 3200 rpm for 10 min at 4°C; supernatant is discarded and pellet is washed with PBS (pH 7.2).

5. DNA extraction buffer (500 µl/tube) is added in tubes. Gently tap to disperse the cell pellet in extraction buffer and keep in water bath for 1.0 hr at 37 °C (it is to ensure that pellet is completely suspended so that cells are accessible to SDS and Proteinase K).

6. 10 % SDS is added (20 µl/ml) to cell suspension and the tubes are gently mixed by inverting the tube. The contents of tube become viscous which indicates lysis of cells. After that sample is handled gently from onward to avoid shearing of DNA.

7. Proteinase K (15 µl) of 20 mg Proteinase K/ml of buffer is added in tubes in two pulse i.e. half the requirement is added to tube in 1st pulse, mixed gently end to end and kept in water bath at 50°C. After 3-4 hrs, the second pulse of the remaining amount of Proteinase K is added and tubes are incubated at 50°C overnight.

8. Equal volume of equilibrated phenol (Tris saturated phenol pH> 7.8 ) is added in the tubes next day morning. Mix the contents of tube gently by inverting the tube for 15 min till a light coffee coloured uniform solution without any balls of phenol is formed and then centrifuge at 3400 rpm for 15 min.

Objective: To isolate DNA from plant sample by CTAB method and quantification by spectrophotometer.

Background information:

DNA isolation from different plant tissues viz., leaf, stem, root, flower and seed is a challenging task due to hindrance of variety of variety of biochemical compounds present and further problem increases with diverge plant species. In case of animal tissues the diversity in cellular bio-molecules in different species is much lower compared to plants. Two major phyto bio-molecules that have wide variation between species and pose serious problems in DNA isolation are: polyphenols and polysaccharides. These phyto bio-molecules if contaminated in DNA then may hinder further down applications like PCR, restriction digestion, sequencing, etc.

Several methods have been developed and reported that can remove polyphenols and polysaccharides efficiently during DNA isolation from plants. For this purpose two different chemicals are widely used,the first one is CTAB (cetyl trimethyl ammonium bromide) that is a cationic detergent and helps in removal of polysaccharides and the second one is polyvinylpyrrolidone that helps in removal of polyphenols. Due to above properties the CTAB based DNA extraction buffer is very common for plant DNA extraction.

Significance of different types of chemicals found in CTAB based plant DNA extraction method is explained as under:

Principle

The rate of joining of DNA fragments is affected by seven parameters:

DNA concentration,

Concentration of compatible ends,

Size of the fragments,

Presence or absence of complementary, single-stranded ends (some nucleases form blunt ends and in these cases special techniques are needed for joining),

G + C content and length of the complementary single strands,

Temperature of the reaction and

Ionic composition of the solution.

ABSTRACT

The process of developing new crop varieties involves many steps and takes several years. In recent times, biotechnological advances have helped in reducing these considerably. Apart from the techniques of haploid culture and genetic engineering, one of the tools which is making it easier for scientists to select plant traits and develop new varieties is the use of molecular markers. Molecular markers can be used for (a) characterization of germplasm (b) varietal identification and clonal fidelity testing (c) assessment of genetic diversity (d) validation of genetic relationships and (e) marker- assisted selection. These have widespread applications in management of genetic resources as well as in breeding programmes. Marker-assisted selection has practically revolutionized breeding programmes. Traditionally, plant breeders have selected plants based on their visible or measurable traits called the phenotype. But this process can be difficult especially in the case of multigenic or quantitative traits. Molecular markers can be used to trace linkages with traits of importance. In the area of horticulture, this is a very useful tool in tree breeding, where the breeder has to wait for several years for phenotypic expression of the desired trait. A number of DNA marker technologies are now available and rapid advances are being made in the development of more sensitive marker technologies. The techniques involved, the various applications of DNA marker technologies in horticultural crops and future perspectives in the national context have been discussed.

Introduction

DNA denaturation, also called DNA melting, is the process by which double-stranded deoxyribonucleic acid unwinds and separates into single-stranded strands during the breaking of hydrogen bonding between the bases. Both terms are used to refer to the process as it occurs when a mixture is heated, although “denaturation” can also refer to the separation of DNA strands induced by chemicals like urea. For multiple copies of DNA molecules, the melting temperature (T_m) is defined as the temperature at which half of the DNA strands are in the double-helical state and half are in the “random-coil” states. The melting temperature depends on both the length of the molecule, and the specific nucleotide sequence composition of that molecule.

Applications of DNA Denaturation

The process of DNA denaturation can be used to analyze some aspects of DNA. Because cytosine / guanine base-pairing is generally stronger than adenosine / thymine base-pairing, the amount of cytosine and guanine in a genome (called the “GC content”) can be estimated by measuring the temperature at which the genomic DNA melts. Elevated temperatures are associated with high GC content. GC ratios within a genome are found to be markedly variable. These variations in GC ratio within a genome of higher organisms results in a mosaic like formation with islet regions called isochores. This results in the variations in staining intensity in the chromosomes. The isochores include in them essential protein coding genes, termed housekeeping genes and thus determination of ratio of these specific regions contributes in mapping these essential genesbacterial systematics has recommended use of GC ratios in higher level hierarchical classification. For example, the Actinobacteria are characterised as “high GC-content bacteria”. In Streptomyces coelicolor A3(2), GC content is 72%. The GC-content of Yeast (Saccharomyces cerevisiae) is 38%, and that of another common model organism Thale Cress is 36%. Because of the nature of the genetic code, it is virtually impossible for an organism to have a genome with a GC-content approaching either 0% or 100%. A species with an extremely low GC-content is Plasmodium falciparum (GC% = ~20%), and it is usually common to refer to such examples as being AT-rich instead of GC-poor.

Preparation of Solutions

GTE buffer

50 mM Glucose,

25 mM Tris-Cl,

10 mM EDTA,

pH 8

NaOH/SDS lysis solution

0.2 M NaOH,

1% SDS

Reagents

EDTA

Ethanol, absolute

Isopropanol

Phosphate Buffered Saline (PBS), 1X

Proteinase K

Sodium Acetate, 3 M pH 5.2 (Molecular Biology Grade)

Sodium chloride (NaCl)

Sodium Dodecyl Sulfate (SDS ), 10%

Tris EDTA (TE), pH 7.4

Tris EDTA (TE), pH 8.0

Tris HCl, pH 8.0

Reagents

Chloroform

EDTA, 0.5 M

Ethanol, absolute

Isoamyl alcohol

Phenol

Phosphate Buffered Saline (PBS), 1X

Proteinase K

RNAse A

Sodium dodecyl sulfate (SDS) solution, 10%

Reagents

Chloroform

EDTA, 0.5 M

Ethanol, absolute

Is amyl alcohol

Phenol

Proteinase K

RNase A

Sodium acetate, pH 5.2

Sodium chloride, 5 M
Sodium thiocyanate (NaSCN), 1 M

TE Buffer (Tris-EDTA), pH 7.4

Tween 20

Xylene

DNA replication. The double helix is unwound and each strand acts as a template. Bases are matched to synthesize the new partner strands.

DNA replication, the basis for biological inheritance, is a fundamental process occurring in all living organisms to copy their DNA. This process is “replication” in that each strand of the original double-stranded DNA molecule serves as template for the reproduction of the complementary strand. Therefore, following DNA replication, two identical DNA molecules have been produced from a single double-stranded DNA molecule. Cellular proofreading and error toe-checking mechanisms ensure near perfect fidelity for DNA replication.

In a cell, DNA replication begins at specific locations in the genome, called “origins”.

Unwinding of DNA at the origin, and synthesis of new strands, forms a replication fork. In addition to DNA polymerase, the enzyme that synthesizes the new DNA by adding nucleotides matched to the template strand, a number of other proteins are associated with the fork and assist in the initiation and continuation of DNA synthesis.

Watson and Crick based on their double helical DNA model, offered to explain DNA replication by a method where each single strand of DNA is template or mold for its complement and a new helix has one old strand and one newly synthesized strand. This type of DNA replication is called as semi-conservative as in this method one old strand is retained and one new complementary strand is synthesized. In contrast to semi-conservative mode of DNA replication, two more modes of DNA replication were proposed. One is conservative type where two new strands are synthesized in form of a double helix while the old double helix remains unchanged. The third type of DNA replication proposed has been dispersive mode of DNA replication which amounts to breaking down of double helical strands into small pieces along the length, their replication and random assemblage with newly synthesized pieces to form a patchwork single string of dispersed old and new pieces. These three modes of replication of DNA molecule are shown in Fig. 40.1.

7.1 Basic concept

What is DNA sequencing?

The genome of any biological organism is a sequence of nucleotides arranged in a specific manner. The nucleotides are chemically a base which usually exists in 4 different forms; Purine – Adenine (A) and Guanine (G) and Pyramidine – Cytosine (C) and Thymine (T). These four nucleotides make up an entire sequence of Deoxyribose Nucleic Acid (DNA) which is encodes the information of any cell in the form of a gene. The genome, therefore, is the complete set of all genes that is required to build and maintain that organism. DNA sequencing is the process wherein the precise order of these nucleotides along the gene is detected and analysed which includes any method or technology that assists in determining the sequence.

DNA Sequencing

DNA sequencing is the determination of the precise sequence of nucleotides in a sample of DNA. Sequencing can be done on a short fragment of DNA to cover the entire genome. The maps thus constructed using the nucleotide sequences in the correct order is called as sequence map.

In 1977, twenty-four years after the discovery of the structure of DNA, two separate methods for sequencing DNA were developed: the chain termination method (Sanger et al., 1977) and the chemical degradation method (Maxam and Gilbert, 1977). Both methods were equally popular to begin with, but, for many reasons, the chain termination method is the method more commonly used today. In chemical degradation method, chemicals specific to each base remove the last base, which has been labelled. The method uses toxic chemicals which required high care while handling.

In chain termination method, DNA polymerase extends a DNA strand in which dideoxynucleotide becomes incorporated terminating the chain extension (phosphodiester formation) at the 3’OH site making an array of fragments differing in length. This method is based on the principle that single-stranded DNA molecules that differ in length by just a single nucleotide can be separated from one another using polyacrylamide gel electrophoresis.