eChapters

Protocol for DNA extraction using the Qiagen DNeasy Blood and Tissue Kit (Catalogue No. 69504) presented here

Contents of the kit: DNeasy mini spin columns (2 ml), collecting tubes (2 ml), tissue lysis buffer (ATL), lysis buffer (AL), wash buffer 1 (AW1), wash buffer 2 (AW2), elution buffer (AE) and proteinase-K.

Note: Check for the validity of the product before dilution. Dilute the ATL and AL buffer with molecular gradient ethyl alcohol to a specified volume mentioned on the bottle before starting experiments. Keep a tick mark the bottle cap after dilution with ethyl alcohol for easy identification.

Equipments required: Microscope, centrifuge, vortex mixture, water bath, pestle and mortar/homogeniser, micropipettes, micro tips, eppendorf tubes, needle, micro scissor, forceps, camel hair brush, thermometer, tube stand, masks and gloves.

Polymerase Chain Reaction (PCR) is a laboratory technique, developed by Kary Mullis in the 1980s, used in molecular biology to amplify and replicate a specific segment of the DNA (Mullis, 1990). This reaction in performed in a thermal cycler, involving three main steps: denaturation, annealing and extension.

Principle: PCR is based on the principle of selectively amplifying a specific region of DNA through a series of temperature-controlled cycles. The key components involved in PCR include the target DNA sequence, oligonucleotide primers, DNA polymerase enzyme (Taq DNA polymerase), deoxyribonucleotide triphosphate (dNTPs) (A, T, G, and C), Mg2+ and a thermal cycler apparatus. Initially, the double-stranded DNA is split into single strands under high temperature of 90-95 0C known as the denaturation step. It is followed by cooling the solution to a temperature that allows proper attachment of the oligonucleotide primers to its complementary sites in the strands, known as the annealing step.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Quantification of DNA is an essential step after its extraction in conjunction with the confirmation of the quality. NanoDrop spectrophometer is a powerful instrument in determining both purity and concentration of nucleic acids on the basis of absorbance values obtained by adding small amount of sample (1-2 μl) on the measurement surface.

Principle: The instrument works on the basic principle of spectrophotometry, which takes highly sensitive fluorescent measurements of the microvolumes. It takes use of microvolume sample retention technology based on surface tension property of the liquid and fibre optic technology. Together, these features make it possible to detect sample even in microlitres, which is much more than the traditional method that need cuvette-sized sample volume. The concentration of nucleic acid sample is normally determined by measuring its absorbance at 260 nm.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

Immunoblotting or Western blotting is a technique employed to observe proteins separated through gel electrophoresis. After the proteins migrate from the gel to a nitrocellulose or PVDF membrane due to an electrical current, the membrane is exposed to antibodies tailored for the desired target. Subsequently, secondary antibodies and detection reagents are utilized to visualize the proteins of interest on the membrane.

1. Preparation of tissue homogenate

The initial phase of sample preparation involves extracting proteins from their origin. Typically, proteins are extracted from cells or tissues through a process called lysis. This procedure disrupts the cell membrane to separate proteins from the insoluble components of the cell. Different lysis buffers are available for sample preparation in Western blotting and they differ in the potency of their detergents used to liberate soluble proteins.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

1. Introduction

Insects, like many other organisms, rely heavily on their diet for essential nutrients that regulate their growth and development. The quality of food intake significantly impacts various aspects of an insect’s life cycle. Research, such as that conducted by Lee (2015) highlights that consuming a diet lacking in essential nutrients can lead to premature aging, a process known as senescence, in insects. Furthermore, such inadequate nutrition can hasten the rate of mortality as the insect ages. This underscores the critical role that proper nutrition plays in the longevity and overall health of insect populations.

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

1.1 Introduction

In the contemporary context, women's empowerment in rural India holds immense significance. These women fulfil critical roles as farmers, wage earners, and entrepreneurs, all while managing family responsibilities such as providing food and caring for children and older people. Despite their vital contributions, rural women face entrenched challenges, including gender based discrimination, societal norms, and unequal access to education, healthcare, property, and financial services. The burden of unpaid work, particularly prevalent in economically disadvantaged households, further compounds these obstacles. Notably, women from indigenous and grassroots communities contribute significantly to their communities’ livelihoods and serve as custodians of traditional knowledge essential for cultural preservation.

1.1 Introduction Rural women worldwide grapple with many challenges, ranging from restricted access to essential resources and limited educational opportunities to constrained pathways for economic advancement. Extensive research conducted by the World Bank has illuminated the persistent struggles faced by rural women, emphasizing disparities in education, healthcare, and economic opportunities (World Bank, 2019). Simultaneously, UN Women underscores the systemic hurdles perpetuating gender inequalities, necessitating urgent and comprehensive solutions (UN Women, 2020).

Amidst these challenges, emerging technologies stand as a transformative force with the potential to reshape the trajectories of rural women. Recognizing this potential, the International Telecommunication Union (ITU) emphasizes the capacity of technological interventions to ameliorate challenges faced by women in rural areas.

3.1 Introduction

Women are the backbone of the family. God gave her all the power to give birth, raise the children, do all the household chores, and balance the professional work. But we forget that women are also human beings, not machines. They can’t work 24x7 they also need rest as well as proper nutrition. Women in ancient India were very powerful in terms of decision-making, political opinion, education, etc, but later on, the situation of women deteriorated. In the middle era, the situation was at its worst: women were being treated badly by the men in their own families. Currently, the situation is turning better. Women are being treated equally now times but it is not the best scenario we can have. There is still much scope in this field where equal wedges and a good environment can be provided to the women.

4.1 Indian Rural Women Embracing the Changes

Rural areas are chiefly characterized by a strong reliance on primary industries such as agriculture, forestry, fishing, and mining (MacTavish, 2020). When examined by occupation, the agricultural sector frequently acts as the foundation of rural economies, employing a sizable percentage of workers in farming, livestock raising, and crop production (Cagliarini & Rush, 2011). Unlike urban areas, rural regions offer fewer non-agricultural employment opportunities, leading to a greater emphasis on self-employment, small-scale enterprises, and seasonal work patterns. Limited access to formal employment prompts reliance on informal sectors such as casual labour and subsistence farming.

5.1 Introduction

“Women give life and play a vital role in safeguarding the ecosystem. Technology is the Plow that furrows the soil of justice, enabling women farmers to plant the crops of sustainable development.”

Women are half the people in the world, and they have done better than men in many ways in the last 30 years. But they still face more problems than men, because they do not have the same access to things like money, land, and power. Gender equality is not only a good thing by itself but also good for the economy, society, and the environment. If women and men have the same chances to do things and make decisions, we can have a better way of development that considers the needs of both women and men.

6.1 Introduction

In its broadest sense, literacy stands as a fundamental pillar of youth development, transcending mere reading and writing abilities to encompass critical skills necessary for navigating today's complex world (UNESCO, 2020). Concurrently, connectivity serves as the backbone of digital transformation, facilitating communication, collaboration, and access to information on a global scale (ITU, 2021). Skill development, particularly in digital literacy, has become indispensable in an increasingly digitized society, empowering individuals to thrive in both personal and professional domains (European Commission, 2019).

7.1 Introduction

The evolution of the digital landscape has been nothing short of revolutionary, shaping the way we live, work, and interact with one another. Since the inception of the ARPANET military experiment in 1968, which laid the groundwork for the internet as we know it today, the world's digitization has been accelerating at an unprecedented pace. What started as a military endeavor has evolved into a global network connecting billions of people across geographical boundaries, giving rise to virtual communities, and fundamentally transforming the way information is accessed and disseminated. As we navigate through this digital age, characterized by rapid technological advancements and an ever expanding digital ecosystem, the role of individuals in this landscape has evolved significantly.

8.1 Introduction

Giving people and companies access to basic financial services is known as f inancial inclusion, and it has long been a problem on a global scale. Millions of people worldwide still lack access to basic banking services like savings accounts, loans, and insurance and are either underbanked or unbanked altogether. Fintech, or financial technology, has emerged as a key player in resolving this problem by providing creative ways to improve banking service accessibility and advance financial inclusion.

One of the main forces behind promoting equitable economic growth and lowering poverty is financial inclusion.

9.1 Introduction

In the 21st century, mass media plays an important role in disseminating quick information among many people and making communication easy. Today, Information and Communication Technology (ICT) plays a significant role in daily life. ICT is the abbreviation for Information Technology (IT), which offers the ability to access information using telecommunication. It is primarily dependent on communication technologies. This incorporates computer system, sound video show and Internet. Information and communication technology is used in the majority of fields, for example, Agriculture, Education, Medicine, Defence, E-administration, E-Commerce, Banking, Transport, and so forth. ICT is assuming an essential job.

10.1 Introduction

The incredible technology usage in e-commerce over the last several years has resulted in the fast growth of e-business enterprises. Technological innovation has created new opportunities for online businesses looking to provide value added services. Technology adoption, enhanced customer support, and creative product development have given businesses the necessary competitiveness. Consumers are more demanding than ever and more aware of their rights. E-commerce businesses are pressured to develop and provide value for their customers in novel ways.

11.1 Introduction

Gendered Advancements utilize strategies of sex and intersectional investigation to form modern information. It looks to saddle the inventive control of this sort of examination for advancement and revelation. The agent's address is, do considering these components include important measurements to investigate? Do they take research in unused bearings? To reply to these questions, Gendered Developments creates down-to-earth strategies of sex, sexual orientation, and intersectional examination for researchers and gives case ponders as concrete outlines of how this sort of investigation leads to revelation and advancement.

12.1 Introduction

Technological advancements have completely changed human existence, bringing about profound societal shifts and stimulating the economy. Empowering women will have a good impact on women's daily lives and is essential to the growth of any society. Women now have many possibilities to showcase their creativity, ideas, and technological prowess both in India and around the world thanks to the advancements and inventions in the field of information technology. This review's main goal is to investigate how women use digital technology in urban and rural areas. India is rapidly digitizing, embracing all facets of technological advancement, and as a result, offering plenty of job prospects for women.To reduce the disparity between genders in technology fields in Indian society, women's involvement in these fields, both in rural and urban areas, must be the main focus.

13.1 Introduction

13.1.1 Bridging the Gap: Towards a More Equitable Digital Landscape

In an age dominated by digital technologies, the concept of a more equitable digital landscape is paramount to ensuring that the benefits of technology are accessible to all segments of society. The term "digital landscape" encompasses not only the physical infrastructure, such as internet connectivity and hardware, but also the socio-economic and educational factors that influence individuals' ability to participate in the digital realm. The digital divide, often exacerbated by disparities in access to technology, internet connectivity, and digital literacy, presents a significant challenge. This paper, titled "Bridging the Gap: Towards a More Equitable Digital Landscape," seeks to explore the multifaceted nature of the digital divide and propose strategies to overcome these challenges.

14.1 Introduction

As discussed above, the development discourse on women nationally and internationally moved from Women in Development (WID) to Gender and Development (GAD) and Women's Empowerment. This was reflected in the Government Plans and Policy Documents throughout the past six decades. Since independence, many schemes have been launched for the emancipation of women in the country.

The social welfare method was superseded by the development strategy in the Fifth Five-Year Plan (1974-1979). This acknowledged the contribution and productive role of women. With its emphasis on work, education, and health, the Sixth Five-Year Plan (1980-1985) marks a turning point in the history of women's growth. The Seventh Five-Year Plan (1985-1990) prioritized projects aimed at improving women's status.

15.1 Introduction

15.1.1 Empowering Women for a Sustainable Future in India

Education and opportunity are key to a thriving future, and investing in women's education empowers not just them but also the next generation. India's vast natural resources offer countless benefits, but centuries of human activity have taken a toll. Unsustainable practices and mismanagement have degraded the environment, threatening the well-being of communities across the country. The evidence of environmental decline is undeniable. Over the past decade, the situation has worsened. Our actions are pushing us towards a potential environmental crisis. India, like the earth itself, sustains a multitude of activities. This has undeniably improved lives, particularly in recent decades.

16.1 Introduction

16.1.1 Definition of Sustainable Ecosystems

A sustainable ecosystem is a complex network of living organisms and their non-living environment that can maintain itself and its processes indefinitely. This includes the interaction of plant and animal life, water, air, soil, and other physical and chemical components. These interactions ensure a delicate balance that allows the ecosystem to thrive and provide essential resources for all living beings, including humans. 

17.1 Introduction

In an era where digital technologies permeate every facet of our lives, the discourse surrounding data privacy and security has never been more pertinent. However, within this discourse lies a critical blind spot the intersectionality of gender and technology. As we navigate the complexities of safeguarding personal data and ensuring online security, it is important to recognise and address the differential impacts experienced by individuals based on their gender identities. The combination of gender dynamics with data privacy and security unveils a multifaceted landscape characterised by unique challenges and opportunities. This intersectionality necessitates an examination that goes beyond conventional approaches, requiring a critical lens that acknowledges the diverse experiences and power dynamics at play.

18.1 Introduction

Unpacking the rural landscape having various challenges due to its complex and composite nature.

The development of successful plans and policies requires an awareness of the following issues.

18.1.1 Heterogeneity of Rural Areas

Rural landscapes are diverse, exhibiting variations in geography, culture, and economic activities. Addressing the unique needs of different regions requires a modulation approach (Cloke & Milbourne, 1992). Different topographies, such as hills and plains, have an effect on farming practices. Economic heterogeneity results from the use of various farming techniques and the presence of various sectors. Socially, these locations are characterised by diverse ethnic groups with a diversity of cultures. Access to healthcare and education is restricted by inequalities in infrastructure and services, which add to the uneven development.

1.1. Introduction: India’s present population, growth rate & projections

India is the second-most populous country in the world after China with its population of about 1.38 billion in the year 2020. The Population Division under the Department of Economic and Social Affairs, of the United Nations, has projected the country’s population to be growing to about 1.50 billion by the year 2030, and 1.64 billion by 2050, of course with its decreasing annual growth rate from 1.04 to 0.25% or so during the period of next thirty years (Fig. 1.1; UNDESA, 2019). The projection says the Indian population will exceed China by the year 2030 even with its decreasing rate i.e. India will be the most populous country by then. As agriculture and allied sectors are the backbone of this country and the largest livelihood source, it support this growing human and livestock population with diversified natural resources and varied agro-climatic conditions. However, the sustainability of agricultural production should be maintained in the face of perturbation and stress on the agro-ecosystem especially the degraded natural resource base and changing climate.

2.1. Introduction

Water plays a pivotal role in this earth system. The withdrawal of water for irrigation is about 70% of the global freshwater. Water use efficiency is less than 50% in many countries. It has been forecasted by the Food and Agricultural Organization (FAO, 2015) that global water requirements will be increased by 50% by the year 2050 to meet the demands of agricultural water use. This is so because food demand will be higher for the growing human population. We have entered into an earth system where everything living has evolved and developed (Cosgrove and Loucks, 2015). There has been a new geological scenario, some say Anthropocene (Crutzen, 2002; Williams et al., 2011). Consequently, freshwater will increasingly be a scarce and the costliest resource in the future, which needs to be managed properly.

3.1. Introduction

Rice is grown in varying geographical locations and climatic situations. Most of the rice area lies between the equator and 400 N latitude and between 700 and 1400 E longitude. It grows well from tropical to sub-tropical warm and temperate climatic regions up to 400 S and 500 N of the equator. However, the highest yields are obtained in the region between 300 and 450 N of the equator. The average yield generally increases as the countries are situated further away from the equator (Chatterjee and Maiti, 1985). In India, rice grows in regions from 80 N to 350 N latitudes under widely varying conditions of the land, rainfall, altitude and climatic conditions. It is grown at the sea level in river deltas as in parts of Kerala, as deepwater in states of West Bengal, Assam and Bihar; at high altitudes of 914 to 1524 m or even more as in Kashmir, and in the slopes of the Himalayas. A temperature range of 200 C to 37.70 C is required throughout the life period of rice crop.

4.1. Introduction

Globally, rice is cultivated on about 165 million ha of land, which provides around 787 million tons of paddy annually (FAO, 2023). In Asia, 708 million tons of paddy is produced from nearly 143 million rice-cultivated areas. Rice crop is grown in a wide range of climates, varied soil types, and hydrological situations. Rice is the lone cereal crop that grows well in floods.

The rice habitat can be divided into four groups based on the hydrology of the rice field: irrigated lowland rice (79~80 million ha), rainfed lowland rice (54~55 million ha), upland rice (14~15 million ha), and flood-prone rice (11~12 million ha) (Table 4.1) (Bouman et al., 2006).

5.1. Introduction

Rice-fallows are a rainfed rice mono-crop production system, where only a single crop (rice) is grown and these lands remain without any crop for the rest of the period of the year (fallow). An estimate shows that rice-fallow areas extended over 22.3 M ha in South Asia, maximum in India ( 88.3%) followed by Bangladesh (8.7%), Nepal (1.4%), Sri Lanka (1.1%), Pakistan (0.5%), and Bhutan (0.02%) (Gumma et al., 2016). The eastern part of India accounts for ~ 84% (9.7 million ha) of the country’s total rice-fallow area (i.e. 11.7 million ha) (Ali et al., 2014; Singh et al., 2017), despite high rainfall during rainy / monsoon season. The reasons are that after the rainy season, irrigation facilities are lacking, very fast depletion of the soil residual moisture due to temperature rise, the poor economic condition of the farmers, and a lack of awareness or knowledge of available technologies. Additionally, delayed harvesting of long-duration rice (150-160 days) results in late sowing of winter crops, which, in turn, exacerbates the temperature and moisture stresses in winter crops (Kumar et al., 2018a; 2018b). Overall, the challenges of growing another crop in rice-fallow areas are the lack of irrigation facilities including declining groundwater levels, the dominance of the long-duration rice varieties cultivation, higher evaporative loss of the residual soil moisture, degradation of soil quality, and poor financial conditions of the farming community with diminishing profit. Recently, climate change with erratic rainfall and delayed monsoon arrival added more challenges for these areas in several places. Deficit soil moisture imposes stress on the crops and negatively affects the winter crops productivity in the rice-fallow system, and several times it results in complete crop failure (Singh et al., 2012; Ghosh et al., 2016).

6.1. Introduction

The growing human population presents a number of issues, including food scarcity, malnutrition, inadequate natural resources (land and water) for agricultural production, and environmental deterioration (MacDonald, 2010). Today, viable intensification of agri-production systems can fulfill rising food, nutrition and environmental demands (Pretty and Bharucha, 2014). Production of rice (Oryza sativa L.), a vital element of food security, which feeds nearly half of the world's population, occupies 143 million hectares of land (FAOSTAT, 2023), and uses up to 90% of all irrigation water in Asia (Liu et al., 2018). For instance, it has been determined that systems for producing rice are one of the main industries that wastes water resources and greatly increases greenhouse gas emissions (FAO, 2013). Therefore, it is necessary to look for ways to manage the rice production system more effectively. In paddy rice systems, co cultivating aquatic animals (fish, shrimp, crab, shellfish, and ducks) and rice has been suggested as a way to reduce the risks of environmental pollution/ contamination linked with rice production while simultaneously optimizing the use of land and water resources to provide humans with both grains and meat (Hu et al., 2016; Ahmed and Garnett, 2011). Co-culture systems have drawn more interest recently due to their potential to reduce the stresses associated with environmental and food insecurity.

7.1. Introduction

The integrated farming system (IFS) is becoming increasingly important for effective farm resource management in order to increase farm productivity, reduce environmental degradation, improve the quality of life for resource-poor farmers, and ensure sustainability. Integration happens when one production sub-system's outputs (typically by-products) are used as inputs in another within the farm unit (Radhammani et al., 2003; Lightfoot and Minnick, 1991). IFS are a mixed farming system made up of at least two distinct but logically linked components of crop and animal enterprises. The integrated farming system is effective in reducing risk, increasing productivity and revenues, and improving the use of organic waste and agricultural leftovers.

8.1. Biofloc aquaculture

Among the innovations in the field of aquaculture, biofloc technology (BFT) has attracted great attention due to its ability to foster the goals of sustainable aquaculture (Khanjani et al., 2022a). If implemented correctly, BFT capitalizes on the existing organisms in water to significantly reduce water use and environmental impact and increase biosafety at farms (Avnimelech, 2012).

9.1. Introduction

Human dependence on natural processes for the goods and services provided by nature, especially food, fuel and fibre, has been a known fact. In recent times, the value of less tangible services, such as climate control, water f iltration, and soil fertility, as well as recreational and cultural services has been emphasized also. Ecosystem services underpin human existence, health, and prosperity. It has been beneficial to humans through the transformations of resources (or environmental assets, including land, water, vegetation, and the atmosphere) into a flow of essential goods and services like clean air, water, and food (Costanza et al., 1997). Ecosystem services are those functions of ecosystems- including agroecosystems that are useful to humans or supportive of human well-being (Kremen, 2005). Services provided by ecosystems receive little notice for their support to human civilization often leading to poor management of the ecosystems. Land use systems influence ecosystem functions, which determine the supply of ecosystem services. Land and water resources are under considerable pressure from the expansion of cultivated and residential lands. Diverse land use in agrarian landscapes not only fosters biodiversity, but also provides potential ecosystem services such as air cleaning by vegetation, natural water filtration by plant roots, natural pest suppression, soil conservation, nutrient retention, and crop pollination by insects, etc. Lowland floodplains or waterlogged land areas are generally more conscious of the benefits provided by ecosystem services. It is important to create awareness among the people on provisioning services provided by ecosystems, such as crops, biofuel, fresh water, natural medicine, wildlife, and several cultural services. Managing ecosystem services, which link human well-being to conservation outcomes, is essential for achieving the sustainable development goals (SDGs) of the United Nations (Zhang, 2017).

10.1. Introduction

Irrigation facilities are created by the Government at huge cost for supplying water to the farmers for raising crops to increase agricultural production. The major and medium irrigation projects are planned, constructed, managed, operated and maintained by the Irrigation Departments, wherein certain procedures and rules are evolved and followed to the delivery schedule of canals, frequency of supply and distribution of water to the farmers, and closing of canals. The creation of such facilities resulted in ushering the green revolution in the sixties and seventies in the production of food grains and also employment generation in the country, thereby improving the socio-economic condition of Indian farmers. However, optimized management of irrigation water is the key to the sustainable development of agriculture and livestock. Since management of water for irrigation is highly location-specific, depending upon agro-ecological and socio-economic conditions, type of irrigation project and land use pattern, it differs from project to project and region to region in the country.

Introduction

The food processing industry ranks fifth in size in the country and employs 16 lakh workers which is 19% of the country’s industrial labour. It accounts for 14% of the total industrial output with 18% of industrial GDP and 6.3% of countries GDP. So, food processing plays a vital role in India’s prosperity. The Food Processing Industry sector in India is one of the largest sector in terms of production, consumption, export and growth prospects. Food processing industry broadly comprises primary processing category and the other categories embracing the secondary, tertiary and further stages of downstream processing. Primary food processing is a major industry with lakhs of rice-mills/ hullers, flour mills, pulse mills and oil-seed mills. There are several thousands of bakeries, traditional food units and fruit/vegetable/spice processing units in the unorganized sector. In the organized sector, there are over 820 flour mills, 418 fish processing units, 6600 fruit/vegetable processing units and 171 meat processing units. Indian processing industries has installed capacity of 21 lakh tones; however these industries actually processed 9.8 lakh tones of the produce. So the total capacity utilization of industries is <30%. There are 70% units in home/cottage/ small scale sector and 30% units in large scale sector with capacity of 250 tonnes per annum and 30 tonnes/hr, respectively. Large scale contributes 70% of the production. The principal crops and commodities which constitute the primary base for the food processing industry and considered important sub-sectors in food processing industries are illustrated in Fig. 1.

Food Safety

The term “safe food” has different standards to different consumers rather than just being the food handled and prepared through proper cleaning, washing and cooking. Safe food means food prepared on clean and sanitized surfaces with equipment, utensils and dishes that also are cleaned and sanitized. Nowadays consumers are extra conscious about the safety and quality of food and for that reason food safety issues have changed, so have society’s methods for making food as safe as possible. Accordingly, “food safety” means assurance that food is acceptable for human consumption according to its intended use (FSSAI 2017).

Introduction

Many post-harvest treatments are applied to horticultural crops, either to maintain the quality (taste, colour, flavour, texture) or improve the visual appeal. Most important of these treatments are temperature management including the cold chain where the temperature of the crop is reduced rapidly and stabilize temperature after harvesting. Exposing the crop to high or low temperature and application of chemicals after harvest helps in managing/ prevent pest and diseases and sprouting occurrence respectively.

Harvested produce must be handled with care at every stage to avoid the mechanical damage and subsequent fungal/bacterial infection. Adopting appropriate post-harvest handling operation will minimize the all ill effects of post-harvest (Fig. 1).

India is bestowed with huge production of fruits, vegetables, cereals, millets, sugarcane along with meat production, milk production, fish production and poultry. Despite such a huge production in India, owing to perishable nature of these produce around 25-30 percent of the produce is being lost as post harvest loss. The one important reason for this may be the production of the crops are season specific and during the peak season the production is more while demand for consumption is less. It may be possible to cut down these losses to great extent, if these produces may be transported from the produces states to those who are not producing due to agro-climatic reasons. So for making transportation of the perishable a successful venture in decreasing post harvest loss, there must be proper cool chain management facilities both at producing site as well as marketing place. The aim of the cool chain management must be to keep the produce in saleable condition during entire storage periods. Some products are stored for short period whereas fresh fruits, vegetables require cold storage. Foods before keeping into the storage room need some pre-storage treatments for better results.

Introduction

Fruits and vegetables are essential constituents of daily diet and are highly demanded in the recent years from most of the population. They are reservoir of vitamins, essential minerals, antioxidants, bio-flavonoids, dietary fibres and f lavour compounds which fall easily victim to abiotic and biotic adversities. Fruits and vegetables are highly perishable and during the post- harvest, there are considerable losses due to microbes, insects, respiration and transpiration.

The important quality factors of fresh produce contributing to the marketability are texture, colour, appearance, flavour, nutritional value and microbial safety. These quality factors are measured by plant variety, ripening stage, maturity stage pre-harvest and post-harvest conditions. The Post-harvest losses of fruits and vegetables are a serious problem because it rapidly deteriorates them during handling, transport and storage. Edible coating over fruits and vegetables are used to improve their quality and shelf life.

Introduction

In this modern era, educated and health-conscious people are increasingly demanding such food products that preserve their nutritional value, retain a natural and fresh colour, flavour and texture, and free from chemical preservatives. Besides, urbanization has extensively affected the life-style of people all over the world. Competition has made their life extremely busy and time has become a very important factor. Hence, recently there has been increase in demand for ready-to-cook or ready-to-use fresh food products of fruits and vegetables along with convenience and safety. This new demand by consumers has opened a new avenue of food preservation known as minimal processing. The products prepared by this processing method are known as fresh cut or pre-pared products. Minimally processed products are also known as lightly processed, partially processed, fresh processed, fresh cut, and pre prepared. It can be defined in many ways for example as "least possible treatment to achieve a purpose". A more specific definition is as the method that "preserve foods but also retain to a greater extent their nutritional quality and sensory characteristics by reducing the reliance on heat as the main preservative action. In a broader way it can also be defined as the processed foods have been slightly altered for the main purpose of preservation but which does not substantially change the nutritional content of the food. Generally minimal processing involves cleaning, washing, trimming, coring, slicing, shredding before packaging and storage at specific temperature. Some of the examples of minimally processed fruits and vegetables include sliced mango cheeks/melons/papaya/apple, pieces of pomelo segments, peeled and cored pineapple, chilled peach, pomegranate arils dressing, shredded lettuce, shelled peas, cauliflower florets, peeled sliced potatoes, diced onion etc. Minimally processed products are important to food service industry such as eateries and catering companies as they offer many advantages over traditional products, with respect to convenience, expense, labor, and hygiene. Even if it is very much liked by people, the production of minimal processed products is limited due to rapid deterioration and short shelf life. Whereas most food processing methods stabilize the products and prolong their shelf-life, minimal processing of fruits and vegetables increases their perishability.

Need to Preserve Food

Food is vital for human existence. Conservation and preservation of food is a prerequisite for food security and it provides economic stability and self reliance to a nation. The need to preserve food has been felt by mankind since time immemorial. The seasonal nature of production, long distances between production and consumption centers and rising gap between demand and supply have made this need even more relevant today. The hot and humid climate of a country like India is quite favorable for the growth of numerous insects and microorganisms that destroy stored crops and cause spoilage of food every year. Spoilage can also occur due to chemical and physiological changes in stored foods. Sea-foods, meat and poultry may carry harmful microbes and parasitic organisms that cause illnesses associated with their consumption. As in other parts of the world, India has also practiced various methods of food preservation such as sun drying, pickling and fermentation which were supplemented with more energy consuming techniques such as refrigeration, freezing and canning. Each of these methods has its merits and limitations. Man has always been on the search for newer methods to preserve foods with least change in sensory qualities. Radiation processing of food is one of the latest methods developed for this purpose.

Introduction

The health and wellness of human being is largely dictated by the consumption of nutritious foods. Understanding the role of foods in maintaining health and cure of diseases has its roots in the ancient Hippocratic and Vedic texts as well as in the canons of Traditional Chinese Medicine (Sharma et al., 2012). Presently, the transition from a traditional to modern lifestyle, consumption of diets rich in fat and calories combined with a high level of mental stress has been the major cause of lifestyle related diseases like coronary heart disease, obesity, diabetes, cancer and hypertension (Moczara et al., 2012; Sharma et al., 2018). Various studies have linked foods as helpful in combating a number of such degenerative diseases (Sharma, 2015).Therefore, the tenet "Let food be thy medicine and medicine be thy food", quoted by Hippocrates about 2,500 years ago is receiving overwhelming interest. There are number of scientific reports emphasizing the importance of consuming biologically active ingredients present in fruits, vegetables, whole grains and legumes to reduce the risk of chronic diseases (Hasler 2002; Das et al., 2011; Sharma and Sharma 2016). Such biologically active ingredients are now popularly known as neutraceuticals. Whereas, the functional foods are the foods that resemble traditional foods but possess demonstrated physiological benefits. In some countries, however, functional foods and nutraceuticals are used interchangeably. Regardless, the main focus of such products is to improve health and reduce disease risk through prevention. The main difference of this category with pharmaceuticals is that they are multi-targeted mixtures and present at low concentration while pharmaceuticals are uni-targeted pure compounds with high dose use. Hence, an overview on the concept of nutraceutical and functional foods, their classification, development and regulations is summarized in this article.

Introduction

It is the process of retaining food over a period of time without being contaminated by pathogenic organisms or chemicals and without losing its colour, texture, flavour and nutritious value. It involves preventing the growth of bacteria, fungi and other microorganisms, as well as retarding the oxidation of fats which causes rancidity.

Objective

• To increase its shelf life, retaining original nutritional values, colour, texture, and favour.

Introduction

Drying is one of the oldest methods of preserving food. Drying and dehydration both can be defined as the process of removing moisture from the foods. It is a simultaneous heat and mass transfer process, wherein heating medium or internal heat generation helps in evaporation of free water molecules from the product. Drying means removal of moisture of food upto a predetermined level where as in dehydration, complete removal of moisture upto bone dry weight of food material. Dehydrated foods have less than 2.5 % moisture content (dry basis) where as dried foods have dry basis moisture content more than 2.5 %. Drying operation consumes energy from 0.38 to 0.63 GJ/ton of food grain. Removal of water from foods using thermal energy thus makes it an energy intensive process. Modes of heat Transfer in various Driers are given in Table 1.Developments in dryer and methods, dryer selection based on form of raw material and typical residence time for various dryer are are given in Table 2,3 and 4, respectively.

Introduction

The drying of fruits and vegetables during the season of abundance in order to preserve them for consumption during season of shortage is an ancient practice. Thus, drying is one of the oldest methods of preservation of the food commodities. It is practiced from ancient times and is a very common method of preservation in the tropical countries like India where conditions are much more favorable for sun drying. All micro-organisms need moisture to grow. So the removal of water in the food is brought down below a certain level at which they are unable to grow. Moisture content from food can be removed by different methods like sun drying (very oldest method and most popular), solar drying, cabinet drying, mechanical drying, tunnel drying, poly tunnel drying, adiabatic drying, spray drying, osmotic drying, fluidized bed drying etc. Grains are mostly dried in the sun. The moisture content of the grains can be reduced to a limit that is safer for their storage by sun drying. Many fruits and vegetables can also be dried by using sun energy. Some coastal areas of the countries fishes are also dried by exposing to the sun. After drying, sometimes the dried products are converted into powder. However, these powders are very hygroscopic and should be packed in airtight. Mango powder is prepared by this technique, but expensive and not popular in India. Nowadays many artificial methods have been developed for removal of the moisture. The relationship between the moisture content and temperature of air during process is referred as Psychrometric relation. An instrument used to measure the humidity (Relative humidity) of the atmosphere is known as Psychrometer (Hygrometer). The residual moisture in vegetable should not be more than 6-8% and in fruits it should be in the range of 10-20%. The dried fruit can be used as such or after soaking while dried vegetable are usually soaked in water overnight and then cooked. Vegetable are considered to be dry when they become brittle. There are generally two drying methods for foods like 1) Natural drying and 2) Artificial drying. The preservation / stability of the dehydrated products is conferred by the abstraction of water, so that the product is unable to support the microbial growth, its chemical forms of deterioration is inhibited and the drastic reduction in the weight / volume facilitate easier handling and marketing. Among dehydrated products, dehydrated onions have largest share of 45%. India is the third largest exporter of the onions in the world next to the Netherland and Spain. Besides this, India exports dehydrated bell pepper, garlic and mushrooms.

Introduction

The process of concentrating a fruit juice / pulp, vegetable juice, medicinal plant extracts or milk to a reasonably thick consistency is called concentration. Thus, concentration is a water removal process from the liquid food materials. The basic principle of concentration is boiling the liquid under partial vacuum at low temperature till desired concentration is reached. With respect to water removal, the concentration process is similar to dehydration. The food concentration is distinguished from drying on the basis of the finished product where the final product called concentrate is still liquid. In concentration process, only liquid food is used while in drying both liquid as well as solid food can be used. Fruit juice concentrates, milk concentrate are valuable semi-processed products for use in the production of value added products like fruit juice beverages and fruit juice powders. Since the water content of single strength fruit juices is very high (about 75-90%), concentration of fruit juices not only provides microbiological stability but also permits economy in packaging transportation, and distribution of the finished product due to reduction in bulk by weight and volume.

Introduction

Fermentation is playing an important role in the human life and is evident from the fact that food can be both spoiled and made by fermentation. A wide range of the fermented food products are consumed by the consumers in their daily routine. It is one for the oldest and ancient method of food preservation. It may have been a mere accident when people first experienced the taste of fermented food. Fermentation became popular with the dawn of civilization because it not only preserved food but also gave it a variety of tastes, forms, and other sensory sensations. Fermentation, along with salting, cooking, smoking, and sun drying, is one of the earliest ancient traditions developed by cultures all around the world to extend the possible storage time of foods. Slowly, people have realized the nutritional and therapeutic value of fermented foods and drinks, and this has made fermented foods even more popular. Bread, beer, wine, and cheese originated long before Christ. Although modern food technology has contributed to the present day high standard of quality and hygiene of fermented foods, the principles of the age-old processes have hardly changed. In industrialized societies, a variety of fermented foods are very popular with consumers because of their attractive flavor and their nutritional value. During food fermentations, the controlled action of selected micro-organisms is used to alter the texture of foods, preserve foods by production of acids or alcohol, or to produce subtle f lavours and aromas which increase the quality and value of raw materials. After drying, fermentation is the world’s oldest food preservation method.