eChapters

Introduction

Commercially laying of poultry birds carried out for a laying year or cycle after that as egg production decreases then they are usually culled when birds starts shedding of feathers. If we still keep these birds after allowing shedding and renewing of feathers birds take sufficient rest to builds up its body reserve of nutrients for next laying cycles. Their production regains 80-83% of the first laying cycle therefore recycling of laying can be carried out by shedding and renewing of feathers which is nothing but the “molting.”

Artificial insemination (AI) technology is one of the important managemental tools for the successful poultry industry. It has several uses and a few limitations also. This technique is performed to avoid the spread of venereal diseases by natural mating and to increase the dissemination of genetic material to a large number of birds. This technique include: semen collection, semen evaluation (physical and biochemical characteristics), semen dilution and preservation and deposition of semen in the female genitalia. Semen dilution is one of the most critical components of AI technology. Several suitable semen dilutors are reviewed for low temperature storage up to around 48 hours.

An understanding of normal values of electrocardiographic indices of healthy dogs and cats is utmost necessary for interpreting an abnormal electrocardiogram. The criteria for normal configuration and measurements of the waves, segments and intervals in an electrocardiogram of healthy subjects provides basis for detecting abnormalities in the electrocardiogram of the ailing animals. The electrocardiogram, like other diagnostic aids, is not an absolute indicator of health and disease and therefore it is required to be interpreted in conjunction with patient’s history, clinical manifestations, and the results of other investigations.

8.1. Malformation

8.1.1. Fusarium

The classical example of Fusarium infection is Fusarium moniliforme which induces malformation in inflorescence, causing mango malformation disease.

The fungal mycelial morphology may vary significantly on different media, and the descriptions here are based upon growth on potato flakes agar (PFA) at 25° C with on and off fluorescent light cycles of approximately 12 h each. The mycelial colony has rapid growth.

The pioneering German microbiologist, Robert Koch, identified a set of four conditions that need to be satisfied to establish that a particular organism is the causative agent of a particular disease. These conditions, known as Koch’s postulates, are:

1. The suspected pathogen must be found associated with the disease in all the diseased plants examined.

2. The organism must be isolated from the diseased tissue and grown in pure culture on nutrient media, with its characteristics described (non obligate parasites) or in a susceptible host plant (obligate parasites), and its appearance and effects recorded

• General considerations

 • Collection of feces

 • Storage

 • Examination of feces

 • Gross examination

 • Microscopic examination

 • Examination of feces for flukes

 • Examination of feces for blood

 • Culture of feces for nematode larvae

 • Sporulation of coccidia.

• General considerations

 • Collection of milk sample

 • Storage

 • Examination of milk

 • Physical examination

 • Chemical examination

 • Cytological examination

 • Bacteriological examination

• General considerations

 • Examination of skin scrapings for mange

 • Examination of skin scrapings for fungi

 • Cultural examination

General Considerations

The skin scrapings are examined for the diagnosis of skin diseases, including parasitic, fungal and bacterial infections and infestations.

• General considerations

 • Scope

 • Exfoliative cytopathology

 • Interventional cytopathology (Biopsy)

 • FNAC

 • Imprint cytopathology

 • Crush smear cytopathology

Deliberate use of natural enemies to control invasive pest in an ecosystem is known as biocontrol. To control invasive weed species, selective pathogens and weed seed predators are employed to reduce the population of the weed to non competitive numbers rather than total eradication of the weed species (Appleby, 2005) These can be insects, herbivorous fish, other animals, disease causing organisms or even competitive plants. This method is comparatively safer to the ecosystem, is cheaper and has long lasting impact. Difficulty in f inding host specific bio-agent with minimum adverse effect on other crop and the environment is a challenge.

Herbicides have received wide acceptance from farmers mainly due to ease of application and effectiveness. After application, herbicide molecules should penetrate plant tissue and get translocated to the target site. Once they reach the target protein they bind to them and disturb metabolic processes in plants by disrupting biosynthetic pathways and damaging cell structures by generating cytotoxic molecules that ultimately kill the plants. In this, the first step is penetration of herbicide into the plant system.

In a cropping systems there may be simultaneous or sequential application of herbicides, insecticides, fungicides, fertilizers, PGR during a single cropping season. The different chemicals will undergo physical and chemical changes as they interact with plant, soil and other chemical substances already applied to the plant or soil. The interaction effect of such chemical substances will be visible only at the later end of the cropping season. The responses observed in the plants can be.

11.1 Introduction

The crossopterygians, primitive, lobe-finned, bony fishes, represent a very interesting group of fish showing many features of amphibians and other tetrapods. They possess paired fins with a large median lobe, fins covered by scales, a cosmine layer, swim bladder as lungs, nostrils that open into the mouth cavity and autostylic jaw suspension.

11.2 Taxonomic position

16.1 Introduction

Fish are primarily designed to swim in the water. Their fusiform body allows for efficient swimming. Swimming is the most cost-effective mode of fish locomotion because fish bodies are supported by water and thus do not require energy to counter gravity. To swim, a fish uses its fins. The caudal fin is primarily used for propulsion, while the remaining fins are used for balance control and f ine maneuvering. However, some Plectognathi fish (Trunk-fish, Parrot-fish, Butterfly-fish, Porcupine-fish, and Trigger-fish, among others) have lost their ability to swim using body flexure and can only move with their other fins.

22.1 Introduction

The blood vascular system of fishes is modified to suit the aquatic mode of life. Fish contains the simplest single-circuit closed blood vascular system.

The structure of the heart in fish varies little. In fish, all of the chambers of the heart are essentially the same. The size and shape of the component chambers may differ. A large heart is found in extremely sluggish fishes with low oxygen requirements. The number and arrangement of valves in the conus arteriosus are the most distinguishing features in various fishes.

23.1 Introduction

Excretion is the elimination of nitrogenous metabolic wastes from the gut and skin of the body. Through excretion, certain substances are removed while others are conserved. Fish are either ammonotelic or ureotelic animals. Kidneys play the most important role in excretion to maintain water-salt balance.

Fish gill ammonia excretion has been investigated for 80 years, but its mechanisms are still up for debate. A new paradigm has been established by the relatively recent identification of the ammonia-transporting role of the Rhesus (Rh) proteins, a family related to the Mep/Amt family of methyl ammonia and ammonia transporters in many living organisms. These proteins also occur as glycosylated proteins in fish gills (Wright and Wood, 2009).

30.1 Introduction

Sexual dimorphism is a condition in which sexes of the same species exhibit morphological differences that are not directly related to reproduction. It is a common and noticeable feature of the animal world. It is extremely important in biodiversity assessments, as well as in biometry, breeding biology, induced breeding, breeding, pheromone biology and other related fields.

38.1 Introduction

To fishery management, understanding the abundance of a given species population is critical to the success of that species’ fishery. In this context, a fish population is a naturally occurring stock of a race of fish that occupy a specific area of space and act as a biological unit. The density of the fish population, on the other hand, is the population size per unit of space.

40.1 Introduction

India has an 8,118-kilometer-long coastline that stretches through nine Maritime States (Gujarat, Tamil Nadu, Kerala, West Bengal, Maharashtra, Odisha, Andhra Pradesh, Karnataka, and Goa) and four Union Territories (Daman and Diu, Puducherry, Lakshadweep Islands, and Andaman and Nicobar Islands). The country also has a Continental Shelf of 0.53 million km2 and an Exclusive Economic Zone (EEZ) of 2.02 million km2. The EEZ’s annual potential yield is estimated to be 3.93 million tonnes of fish.

45.1 Introduction

Mosquitoes of various species breed in ponds, swamps, gutters, and other bodies of stagnant water, carrying parasites that cause malaria, filaria, dengue fever, chikungunya, Japanese encephalitis, Zika and yellow fever. Various approaches have been used to control mosquito populations to reduce the incidence of vector borne diseases, including chemical, physical, and biological measures. In all types of habitats, biological control against mosquito vectors is safe, friendly, and cost effective. Mosquito biological control entails introducing natural enemies such as parasites, disease organisms, and predatory animals into the environment.

Information and Communication Technology: Concept

ICT refers to an extensive array of systems and technologies dedicated to managing and delivering information and facilitating communication. This includes digital platforms such as the internet and the World Wide Web, as well as traditional media like radio, television—through cable and wireless methods—mobile phones, and printed materials. Accompanying these technologies are services and applications such as videoconferencing and online learning that utilize these mediums.

Introduction

Impact studies isolate the effect of an intervention by assuring that there is clean comparison between a treatment group that received the intervention and a comparison group that is just the same except that it did not get the intervention.

Impact studies test whether one thing causes another. Just knowing scores have gone up following an intervention doesn’t mean improvement is attributable to that intervention.

The data are generated from an impact study used to identify best practices, to replicate successful programs or policies, and to avoid mistakes that might have negative implications for future projects.

India is primarily an agriculture based economy, which implies, agriculture dominates the nation’s economic landscape. In the course of socioeconomic growth, agriculture is crucial. Around 58 per cent of the population in India rely only on agriculture for their livelihood. In India, agriculture acts as an important source of living for about 60 per cent of the population (India Brand Equity Foundation, 2021) and almost 70 per cent of rural households depend on farming. The farming sector in India contributes significantly to the economy, making up about 29 per cent of Gross Domestic Product (GDP) (Balkrishna et al. 2021).

Introduction

Forest restoration is a complex process that requires many steps to ensure successful forest establishment. These steps include choosing suitable tree species and provenances, applying nursery cultural practices to produce quality seedlings and making site modifications to improve the physical environment of the restoration site (Grassnickle, 2000). Conifers are the most important tree species of the western Himalayas and J&K. There are about 16 species spread over 9 genera in 3 families. Among these families, Pinaceae, with seven species in 4 genera, is the most dominant, while Taxodiaceae, with 2 species in 2 genera, is the least represented. Out of the total taxa, 7 species belonging to 5 genera are exotic and exist in cultivation only.

Conifers are valuable natural resources of the country, which contribute substantially to its socio-economic development by providing goods and services to the people and industry. They generate considerable revenue and also play a major role in enhancing the quality of the environment by influencing the basic life support system. Unfortunately, however, they have been subjected to over- exploitation and biotic pressure in the last many years, thereby threatening the very existence of some species such as yew, chilgoza pine etc. The genus Pinus is, in fact, one of the largest and most divergent of the coniferous genera, comprising about 95 species and numerous other varieties and hybrids. They are distributed widely in the northern hemisphere, chiefly in the temperate and cold climates.

Introduction

A forest is a complex ecosystem, predominantly composed of trees and shrubs, which usually form a closed canopy. They form a storehouse of a large variety of life forms such as plants, mammals, birds, insects, reptiles etc., besides being the most important habitat of the microorganisms and fungi, which do the important work of decomposing dead organic matter, thereby enriching the soil. Nearly 4 billion hectares of forests cover the earth’s surface, roughly 30% of its total land area. The forest ecosystem has two components- abiotic and biotic. Climate and soil type form a part of the non-living component and the living component includes plants, animals and other life forms. Plants include the trees, shrubs, climbers, grasses and herbs in the forest.

Soil-borne plant pathogens cause significant losses in the nursery plantation of agricultural, horticultural and forestry plantation stands. These pathogens can survive in the soil for many years through their resistant structures. Besides, the diseases caused by them are difficult to predict. Soil factors like soil type, texture, pH, moisture, temperature, level of organic matter and nutrient content influence the activity of soil-borne pathogens and diseases. In order to survive successfully, these pathogens compete with others for nutrition, space and other requirements. Understanding the dynamics of these pathogens and other microbial populations in the soil in relation to environmental conditions is essential for the successful management of these diseases.

The management of diseases and pests is a major challenge. Monoculture, excess use of fertilisers, high- yielding varieties, climate change etc have not only intensified plant diseases, but also given rise to new diseases or intensified those diseases which were earlier considered of minor importance. Although decades of research have given rise to certain promising organic and biological alternatives to chemical disease management, due to the lack of proper attention of researchers worldwide, the organic and biological disease management technologies are still not very popular.

Catheterization is done for both diagnostic as well as therapeutic purpose. As a diagnostic technique it is employed to collect urine samples, prostatic wash and suction biopsy. As a therapeutic technique it is used for the treatment of urine retention, obstruction and for monitoring urine output. Pneumocystography is a contrast radiography. It is being employed to distinguish the urinary bladder from other organs and to visualize the details of the bladder.

Catheterization

An appropriate catheter needs to be selected as per the requirement (purpose of catheterization and duration of catheterization). A soft, silicone flexible catheter is appropriate for indwelling purpose. Whereas a rigid catheter is more desirable to unblock a small calculi and collecting samples for diagnostic purpose. Small size catheters are best in order to minimize urethral trauma.

It is an easy, non-invasive, bed side technique for continuous monitoring the saturation of oxygen bound to hemoglobin (SpO2). The technique was invented by Dr. Takuo Aoyagi in 1974 to measure oxygen saturation in the blood. During recent years it has shown great utility in patient care. The oxygen saturation of hemoglobin provides a measure of cardio-respiratory functioning. Pulse oximeters generally used in humans are not appropriate for the use in dogs and cats as these are designed to apply on fingers and programmed with the oxygen hemoglobin dissociation curve for humans.

Indications

Pulse oximetry is an important standard technique of patient care in cases of heart failure, respiratory failure, multiple organ failure, critical care, emergency, accident and during anesthesia.

Electrocardiography-A noninvasive Technique

Electrocardiography is a non-invasive diagnostic technique routinely used to examine the electrical activity of the heart in health and diseases. It is an important tool for the clinical evaluation of the heart. The technique provides important information regarding heart rate, heart rhythm, impulse formation and its conduction. Heart size can also be assessed to some extent in humans and dogs. The process of electrocardiography leads to generation of an electrocardiogram as a consequence of depolarization and repolarization of heart muscle cells during each heartbeat.

Pesticide Authorities

Central Insecticides Board and Registration Committee

In India, the central pesticide board and registration committee oversee the import, production, sale, transportation, distribution, and use of insecticides. Pesticides in India are regulated by the following two government organisations Central Insecticides Board and Registration Committee CIBRC and Food Safety and Standards Authority of India (FSSAI ).

Central Insecticide Board (CIB)

• The Central Insecticides Board advises the central and state governments on technical issues arising from the administration of this act, as well as carrying out the other tasks given to it by or under this act.

Mouthparts of insects vary among insects of different groups depending upon their feeding habits. They are mainly of two types viz., Mandibulate (feeding mainly on solid food) and haustellate (feeding mainly on liquid food). Insect mouthparts have become modified in various groups to perform the ingestion of different types of food and by different methods. Indeed the modifications in the mouthparts to ingest almost all kinds of the food material, are one of the factors for the success of the group.

1. Biting and chewing type: e.g. Cockroach & grasshopper.

The typical thoracic leg consists of six parts, basal coxa that articulates with the thorax in the pleural region, small trochanter, femur, tibia, segmented tarsus, and pre-tarsus. The coxa is often divided into two parts, the posterior and the anterior (usually the larger part) being called the meron. The trochanter articulates with the coxa but usually forms an immovable attachment with the femur. The femur and tibia are typically the longest leg segments. The tarsus, which is derived from a single segment, - is usually subdivided into individual tarsomeres. The pretarsus may consist of a single claw, but it is usually composed of a pair of moveable claws and one or more pads or bristles. Legs are usually looked upon as the principal organs of terrestrial locomotion.

The complete system of veins of a wing is termed venation or neuration. Generally in all the insects, there is some similarity in wing venation and therefore, it is presumed that all types of wing venation have developed from the common base or the same ancestor. Using an extensive study of wing venation in different groups of insects, Comstock and Needham constructed a hypothetical type of wing venation from which all other types have presumably been derived. According to them the primitive wing venation has developed from two tracheae which are situated on the anterior and the posterior basal margins of wings and their branches are spread all over the wing.

Agarose gel electrophoresis is used to resolve DNA fragments on the basis of their molecular weight. it will be visulaized by exposing to UV light. Principle: As the phosphate backbone of DNA is negatively charged, the basic principle is the migration of DNA molecules from negative (cathode) to positive (anode) charge under constant electric field. The DNA will be separated mainly on the basis of their size, DNA conformation, concentration of gel and voltage. The distance travelled by the DNA molecules tell us about their molecular weight, where smaller DNA fragments will travel farther than the larger ones due to constant mass/charge ratio of DNA. The separated DNA molecules will be then visualised under UV light in gel documentation system after staining with suitable dye.

Aim: To identify culturable gut bacteria from insects.

Materials required: Micro scissors, Micro pestle, 1.5 ml centrifuge tubes, Pipettes, Petri plates, Inoculation loop, 0.5 ml PCR tube, Glass slides, non absorbent cotton etc.

Instruments required: Autoclave, Refrigerator, Laminar Air Flow, Homogenizer, Biological Oxygen Demand (BOD) incubator, Thermal cycler, Gel Doc unit, Deep freezer pH meter, Spirit lamp.

Chemicals required: 70% ethanol, Phosphate Buffer Saline (PBS solution, pH 7.4), Distilled water, 0.01 M TE buffer, Forward primer - 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and reverse primer - 1492R(5′ AAGGAGGTGATCCAGCCGCA), PCR Master mix, Nuclease free water, Agarose, Ethidium bromide, crystal violet, Grams’s iodine, 95% ethanol, Safranin, 3% hydrogen peroxide, Tryptophan broth, Kovac’s reagent, King’s Base agar.

The polymerase chain reaction (PCR) stands out as a highly potent technology within the realm of molecular biology. With PCR, particular sequences present within a DNA or cDNA template can undergo replication, termed “amplification,” increasing their quantity manifold, ranging from thousands to millions. This process entails the utilization of sequence-specific oligonucleotides, a DNA polymerase capable of withstanding high temperatures, and thermal cycling.

Real Time PCR, a variant of the standard PCR technique, serves as a prevalent method for quantifying DNA or RNA within a sample. Through the use of sequence-specific primers, the quantity of copies of a specific DNA or RNA sequence can be assessed. This is achieved by monitoring the amount of amplified product at each stage throughout the PCR cycle. Earlier cycles exhibit amplification if a particular sequence (DNA or RNA) is abundant in the sample, while amplification in later cycles indicates scarcity of the sequence.

1. Introduction

Organisms are known to experience stress when environmental conditions, such as temperature, photoperiod, and humidity deviate from their optimal range. Organisms that respire aerobically constantly generate reactive oxygen species (ROS) through metabolism and employ antioxidants to reduce excess ROS formation and maintain a redox balance (Juan et al., 2021). ROS play crucial roles in cell signaling (Sies and Jones, 2020), homeostasis, cell death, immune defense against pathogens, and the induction of mitogenic responses (Dröge, 2002). Therefore, optimal environmental conditions maintain a balance between ROS formation and antioxidant processes in all living organisms.

Introduction

Citrus fruits are acidic, exotic fruits with juicy, bitter, fruit segments inside. Citrus fruits commonly originated in tropical and sub-tropical regions of the world. They have long been valued as part of a nutritious and tasty diet. The f lavours provided by citrus are among the most preferred in the world, and it is increasingly evident that citrus not only tastes good, but is also good for people. Citrus fruits have certain therapeutic properties such as antitumor, anti-inflammatory and anticancer, due to phytovitamins and nutrients present in them.

Brainstorming is a group creativity technique by which efforts are made to find a conclusion for a specific problem by gathering a list of ideas spontaneously contributed by its members. The term was popularized by Alex Faickney Osborn in the 1953 book Applied Imagination. Osborn claimed that brainstorming was more effective than individuals working alone in generating ideas, although more recent research has questioned this conclusion. Today, the term is used as a catch all for all group ideation sessions.

Origin

Advertising executive Alex F. Osborn began developing methods for creative problem solving in 1939. He was frustrated by employees’ inability to develop creative ideas individually for ad campaigns. In response, he began hosting group-thinking sessions and discovered a significant improvement in the quality and quantity of ideas produced by employees.

15.1 Introduction

Curry leaf is an important perennial tree vegetable cum spice crop of India mostly used in South Indian culinary preparations for flavouring food stuff. It is an under exploited crop. The leaves have slightly pungent, bitter and feebly acidic taste and they retain their flavour and other qualities even after drying. Curry leaf is used in many of the Indian Ayurvedic and Unani prescriptions. It has many industrial values and medicinal uses. Its leaves, roots and bark are credited with tonic, stomachic and carminative properties. Leaves are reported to cure piles and allay heat of body. The green leaves are said to be eaten raw for treatment of dysentery. External application of pulped bark and root is reported to relive eruptions and bites of poisonous animals. An injection of toasted leaves is used to stop vomiting. The tribal people of India use its ground bark to rub on the bitten Part As a snake bite remedy. The powdered leaves are also used to aid in healing of fresh cuts. The dried curry leaf powder is also a good spice powder for use in the food stuff preparation and is exported. Fresh leaves on a steam distillation under high pressure yield 2.6 % (curry leaf oil) volatile oil which is used as fixative for heavy type of soap and perfume. Rectified leaf oil is deep yellow in colour with a strong spicy odour and pungent clove like taste. A volatile oil, a crystalline glucoside ‘Koenigin’ from the leaves and ‘Murayam’ from the flowers are industrial products. Curry leaf is grown on large scale in West Bengal, Assam, Deccan plateau, Western Ghats, Tamil Nadu, Karnataka and Kerala. It is cultivated in Coimbatore, Salem and Tiruchirappalli districts of Tamil Nadu on a commercial scale.

16.1 Introduction

Portulaca is an annual potherb, but may be perennial in the tropics. In many parts of the world, it is still regarded as a weed with nutritional potential. Its young stems and leaves are succulent and edible with a slightly acidic and salty taste. Stems are glabrous, fleshy, purplish-red to green, arising from a taproot, often prostrate, forming mats. It is described as a power food of the future because of its high nutritive and antioxidant properties. It contains more omega-3 fatty acids (300 to 400 mg/100 g of fresh leaves) than any other leafy vegetable plant. Succulent leaves and stem also contain dietary minerals, such as calcium, phosphorus, iron and potassium, as well as vitamins A, C and E and some amount of vitamin B and carotenoids. It has been recommended as a cholesterol lowering agent and as a therapy for arteriosclerosis. Generally, roots and leaves contain more iron and manganese than stems. Due to oxalic acid and nitrate content, excessive consumption of purslane is not recommended. The cultivated form of Purslane, i.e., Portulaca oleracea (garden or green purslane) and Portulaca sativa (yellow leaves, less hardy than the green purslane but possessing the same qualities), is hexaploid. Purslane is a succulent and well-branched herb, leaves are spirally arranged, flowers are yellow, stamens 7-10, style with arms, fruit ovoid, capsule, seeds numerous, tiny and black in colour.

Introduction

An integrated approach to understanding the changing dynamics in water resources involves taking into account various factors that influence the management of water resources under changing climatic conditions (Pahl-Wostl, 2007). It is a holistic approach that combines different disciplines, including hydrology, climatology, ecology, geography, and social sciences, to develop a comprehensive understanding of water resources. The integrated approach is essential for several reasons, including addressing climate change impacts, sustainable management of water resources, enhancing water security, addressing water quality issues, and promoting collaboration among stakeholders. Climate change is causing alterations in precipitation patterns, melting glaciers, and changes in river flows, affecting water availability and quality. An integrated approach helps in understanding the climate change impacts on water resources and developing adaptation strategies (Asif et al., 2023).

Introduction

After harvesting of crop, a huge or less amount of residues get produced from crop fields. Crop residue is the most reachable and ready to serve form of biomass. For agricultural lands, to improve soil quality, crop derived residue is considered as “the greatest source of soil organic matter” (Tisdale et al., 1985). But for farmers, the easiest way to get rid of this residue is on farm burning of it. This type of residue management practices not only give rise to fire hazards and one of the main source of atmospheric pollution but also lead to loss of nutrients and organic matter from soil. The Ministry of New and Renewable Energy, reported that almost five hundred M tons of crop remains is produced every year from India. It has also been reported that a major part of these crops remains is being used in the form of fodder, forage and other industrial purposes. In India, farmers burn their crop residue for feasible management of it, although it costs a lot to our soils. It is estimated that various crops residue contains around 80 percent of Nitrogen, 25 percent of Phosphorus, 50 percent of Sulphur and nearly 20 percent of Potassium and thus, crop residue burning causes loss of these nutrients. The burning of the one tonne of residue leads to loss of 5.5 Kg Nitrogen, 2.3 Kg phosphorus, 25 Kg potassium and 1.2 Kg sulphur, along with the nutrient loss, burning also hampers organic carbon in soil as well as increase in greenhouse gas emission. It also leads to climate change. In agriculture, loss of nutrients from soil depends on the crop which is burned. Sugarcane trash is responsible for maximum nutrient loss followed by rice and wheat straw.

U value: U value is a measure of the heat transmission through a building part (wall or window) or through a given thickness of a material (insulation). U values with lower numbers indicate better insulating properties.

Ubiquinone: It is one of the groups of lipid soluble quinones that are found especially in mitochondria and have a long isoprenoid side chain, and function in oxidative phosphorylation as electron carrying coenzymes in electron transport.

UHT milk: This milk is homogenized, heated to atleast 135oC for about 2-3 second, cooled rapidly and then packed in sterilized containers aseptically. The milk in packs can be stored for several months with out refrigeration. The nutrient loss is negligible. Used for making yogurt commercially as it does not need to be boiled again.

UHT pasteurization: The milk is heated to ~150oC for a fraction of seconds practically no holding period. It is also called ultra pasteurization.

UHT sterilization: It is method in which food is sterilized, cooled and then aseptically placed in previously sterilized containers which are subsequently sealed in an aseptic environment.

Ulcer: A break in skin or mucous membrane with loss of surface tissue, disintegration and necrosis of epithelial tissue (often with pus). It is something that festers and corrupts like an open sore.

Ulcerate: A tissue or skin thatbecomes affected with an ulcer is called ulcerate.

Ulceration: The process of becoming a tissue or skin ulcerated is called ulceration.

This chapter describes fundamental terminology and lays the foundational framework for the course. It offers a general understanding of statistics, its purpose, and its role in addressing diverse problems across various fields of study. Additionally, it explains the rationale behind choosing R software as a powerful tool for data analysis.

Basic Concepts and Terminology

Statistics is an essential tool in agriculture, helping researchers to collect, analyze, interpret, and present numerical data related to plant traits, and agricultural practices. The fundamental goal is to make informed decisions and enhance crop yields, quality, and resilience.

To illustrate, researchers choose to work with a sample due to practical considerations, such as time and cost constraints. For instance, in a field with 10,000 crop plants, a researcher aims to determine the average plant height in the field. To conserve time and resources, they randomly select 200 plants from various locations within the field. These 200 plants constitute a sample from the entire population of 10,000 plants. By analyzing the height observed in the sample, the researcher can conclude the average height of the entire crop field.

This chapter begins by providing an essential overview of different data transformation methods and their importance. It primarily concentrates on exploring three crucial transformation techniques: the square root transformation, log transformation, and arc sine transformation. Additionally, this chapter explores the practical application and analysis of these transformations using the R programming language.

Data Transformation

Data transformation is often needed in statistical analysis and data processing for several key reasons:

• Assumption of homogeneity of variances: ANOVA requires that the variances within each group being compared are equal. When this assumption is violated, i.e., when variances are significantly different across groups, data transformation can help stabilize these variances.

• Normality assumption: ANOVA assumes that the residuals (the differences between observed and predicted values) are normally distributed. However, real-world data often deviates from this normal distribution. Data transformation, such as log or square root transformations, can help in reshaping the distribution of data.

• Handling skewed data: In situations where the data is highly skewed, the results of ANOVA can be misleading. Transformations can reduce skewness, making the distribution more symmetric and suitable for ANOVA.

• Proportional or percentage data: When dealing with data in the form of proportions or percentages, certain transformations (like the arc sine transformation) are necessary. This is because proportions have a bounded scale (0–1 or 0–100%) and their variances are not constant across the range, which can violate ANOVA assumptions

In this chapter, we explore Latin square design (LSD), a specialized form of experimental design renowned for its efficiency in controlling variation. This chapter thoroughly discovers the foundational principles, structure, and application of LSD in experimental research. It details mathematical models for LSD and guides readers through the interpretation of ANOVA tables. Furthermore, the chapter provides a systematic approach to conducting LSD analysis using R software.

Latin Square Design

The LSD is a statistical design used extensively in experiments, especially when specific conditions are met:

• Controlled variation in two directions: LSD is particularly suited for experiments where variation can be controlled along two different factors. This design structures the experimental units into a square matrix, allowing two sources of variability to be accounted for.

• Adherence to experimental design principles: Like other designs, LSD follows the key principles of randomization, replication, and local control. Randomization in LSD is applied within the rows and columns of the square matrix, ensuring unbiased treatment comparisons.

• Efficient use of resources: LSD allows for an effective utilization of resources by controlling two variables simultaneously. This makes it a more efficient design compared to RBD or CRD when there are two sources of nuisance variables.

Agostini M., Enzo M. V., Bedin C., Belardinelli V., Goldin E., Del Bianco P., and Nitti D.

(2012). Circulating cell-free DNA: a promising marker of regional lymphnode metastasis

in breast cancer patients. Cancer Biomarkers 11 (2-3), 89-98.

Badowska-Kozakiewicz A. M., and Malicka E. (2012). Immunohistochemical evaluation of

expression of heat shock proteins HSP70 and HSP90 in mammary gland neoplasms in

bitches. Polish Journal of Veterinary Sciences 15 (2), 115-18.

Beffagna G., Sammarco A., Bedin C., Romualdi C., Mainenti M., MolloA. and Zappulli V.

(2017). Circulating cell-free DNA in dogs with mammary tumors: short and long fragments

and integrity index. PLoS One 12 (1), e0169454.

Birdi R., Kumar B. S., Gupta K., Kashyap N., & KumarA. (2019). Circulating level of heat

shock protein 27 is elevated in dogs with mammary tumors. 3 Biotech 9 (6), 1-9.

Campos L. C., Lavalle G. E., Estrela-Lima A., Melgaço de Faria J. C., Guimaraes J. E., DutraA.

P. and Cassali G. D. (2012). CA 15.3, CEA and LDH in dogs with malignant mammary

tumors. Journal of Veterinary Internal Medicine, 26 (6), 1383-88.